Basic Information

Symbol
BTG2
RNA class
mRNA
Alias
BTG Anti-Proliferation Factor 2 PC3 NGF-Inducible Anti-Proliferative Protein PC3 BTG Family Member 2 TIS21 APRO1 Nerve Growth Factor-Inducible Anti-Proliferative B-Cell Translocation Gene 2 Pheochromacytoma Cell-3 Protein BTG2 MGC126063 MGC126064 BTG Family, Member 2
Location (GRCh38)
Forensic tag(s)
Wound age identification Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_006763.3
Sequence length
2729.0 nt
GC content
0.5049

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-949.80 kcal/mol
Thermodynamic ensemble
Free energy: -998.52 kcal/mol
Frequency: 0.0000
Diversity: 855.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.(((((.((.(((((..(((.......(((((((((...........))))..)))))(((.....))))))..))))))).))..((((((((.(((((((.((...(((.......((((((((((((.(((.((((..(((((...........))))))))).))).)))...)))).((.(((((((((.....((((((..(.((((((.(((((((..(((((((((...........(((....)))...((((((((...((((..(((((((.((((.................(((((...)))))....)))))))))))))))...((((.(((.((..((..((((((...))))))..))...)))))))))(((.((((((((((.(((...))).)))).))).))).)))..)))))))).....((..(((((((.((((((..(((((.((......)).)))))))))))...)))))))..)))))))).)))((((((((((((((((...........((.((((((((....(((..(((.....(((((.......)))))..)))..)))...)))))))).)).((((.((.(((............)))))..)))).((((((((.(((((..(((......)))...))))).)))))))).((((((((((((((.....))))))))............)))))).)))).))))))).....)))))......))))))))))))).)..))))))....))))))))).))((.(((...))).))..((((((.(((((((.(((((((((..(((.....)))......((((((.((((((.(((((((..((..(((..((((.((((((((((((((..((((.((..(.((((((.((((((((...(((..((((((((.((((((..(.......)..)))))).))))))))((((((............))))))(((((.......)))))(((((.((((((((((..((((......))))..........(((((.....)))))))))).)))))..)))))....)))...)))))))).)).)))).)..)).))))..))))).........))))))))).......((((((((((((((.((........((((.....)))).......)).)))).)))))))))).(((((((((((..((((.(((...((((((.(((((((..((((((((.(((((((......((...((....)).)))))))))....(((((((..........((((((((((......)))))((((...(((((((((((((.....))))))))))))))))).((((((((.(((((((..(((((.(((.((.(((...((((((((.(((((...(((((((((((....)))))).((((((((...(((((....((((((.............)))........(((((((((..((................))..))))..))))).....)))......)))))..))))))))................((((((.((((..(((((((.(((((.((........)).))))).)))))))..)))).)).)))).((((((......)).)))))))))...))))).))))).)))..))))).))).))))).))))......))).)))))))))))))..(((((((((((.(((...))).)))))))))))...............(((........))).....((((((((.(.((((((...)))))).).)))))))).(((((.......)))))...((((..(((.((...(((((..((((((.....))))))))))).)).)))..))))..))))))).((((((.......))))))(((((.((.....)).)))))...((((((.......))))))))))))))....))......(((((..((((((((.(..((((....((((((...))))))))))..).))))....))))..))))).))))).))))))........))).)))).)))))))))))....((((.........))))............))))..)))..))....)))))))....))))))..)))))))))))...)))).))))))).)))))).......)))))......))).)).))))))).((((((.((((((((((((......))))).....(((.((((((((((((..((((......)))))))))))))))).)))....)))).)))....(((((((.((((....))))...)))))))..)))))).((((.((....)).)))).....))).)))))(((((((...((((.....(((.......((.((((.........)))).))........)))..)))).))))))).))))).....((((((((((((...(((((.((..(((...(((((((((((((((((..((..(((((((.....(((.....)))......)))))))...))..)))))....))))))))))))....)))..)).)))))))))............))))))))....
Thermodynamic Ensemble Prediction
,{.(({{(.((.(((((..((({......(((((((((...........)))).,))))),{{.....}}))))..))))))),}|.{((((({{{.(((((((.{,.,,{,{.({{...((((({,{((({,{{{,{{|{,.{((((,,,.,,,,,,,|||||||}|{|||{||,,,.||,,||{,.|||||..||}||||||.|||||,(((((((((((((({,(((({{{({.....,,,,..,(({{,.,,,...{(((((((...((((..(((((((.((((.....,,,,........||||{...}}}}}....)))))))))))))))...{{||.|((.((..((..(((({(,..}}))}),,)}...))})))))}((({((((,,((((.(({...})).)))).,))})),.}))|,|}}}}})},{.,,{(,{(((((((.((((((,{(((((.((......)).)))))))))))...))))))).})}}))))}}))}|||||{(({{{||{({,..........((.((((((({,...(((..(((.....(((((.......)))))..)))..)))...)))))))).)).{(((,((.(({............}))))..}})}.((((((((.(((((..{((......}})...))))).)))))))}.((((((((((((((.....)))))))),...........}))))}.,})),||||||,...})))))}))))},)))))})))))}},},.}))})},},}}}}}||}))|})||,,{|,|}|||}}}..,||||({((({|((.{((((((((((.((.((..{((({..({((((((.((((((.(((((((((((((((....(((.((((((((((((((..((((.((..(.((((((.((((((((...((({(((((((({.((((((..(.......)..)))))).}))))))))|,(((....},,...{{||||,.,,,,,.....,})))))(((((.((((((((((,.((((......))))..........,{{{,.....}}}))))))).)))))..)))))....)))...)))))))).)).)))).)..)).))))..))))).........)))))))))..,}}..((((((((((((({.((...,{{..((((.....))))..,},..)).})))))))))))))){(((((((((((..{((({((,...((((((.{((({((,{(((({{{{(((({{,,{{{{{{{{(.,((,,{{((,((,,,.,||}}}.{{|||||},,.....,|(((||.,{,|,,,...,,,|{((((...(((((((((((((.....)))))))))))))))))}{{((((((.,{{({|{..{((((.,((.{,,(({...{{{((({(.{((((...{{(((((((((....)))))).((((((({..,(({{{....,,,{{|,||,,..,,..}})),........{((({{|||.,|{,,,,,,,.........))..))}|..}}}}|,....}}}....,,||||}..}})))))}.,.....,.},.....((((((.((((..(((((((.{((((,({........)).))))}.)))))))..)))).)).)))).|{((({.....,|||||||}||}|,..|||||.}}}}}.|||,.}}})),)}..)))}),))))..}}..)),.))))))))}})))..(((((((((((.(((...))).)))))))))))...,,,.......,,||{......,||}|||,,..,{{{{{(,{.((((({...)))))).}.)))))))|||{{,,...({{{,||.{({{.......}))}|..}))),,.,|||||,...,,|||||||||||{||{||.{{{{|....},,)))}((({,,....}||)|||}}{({{{.((.,,..)}.))))).}}((((((.......)))))}}})}}})},...}},.....{{{{{..|||||{{{|(,.((((,,..((((((...})))))})}),,)}))}},},,))}).,}||||.}}))).)))))}...}}},.}}}.)))).))))))))))),},,,,}}},..,})))))))...........,,||{....))},,,...)))))))....))))))..)))))).))...})))))).)).))))))))))...,,.,})))).|,,.,})}.}}.))))))),(({(((,{{.|||,||{,,..{{,,|,,||{{{,,{((.((((((((((((..((({......)))))))))))))))).)}},,}}}},}})}}.,,.(((((((.((((....))))...))))))),,}||||}.|,||}|,,..,)}})))),},},))).}))}||||{{{{...{{{{,.,,,{,,.......{{.((((.........}))).)}........)))..)))).)))))))}))))),,,..(((((((({(({,..{{(((.{(..(((,,.(((((((((((((((((..((..(((((((.....(((.....)))......)))))))...))..)))))....)))))))))))).,,.)))..}},))}}))}}),.,.........))))))))....

Transcripts

ID Sequence Length GC content
AGAGCCCGAGCAGCGGCCAGGGUAACGCUGUCUUGUGGACCCGCACUUC… 2729 nt 0.5049
Summary

The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein is involved in the regulation of the G1/S transition of the cell cycle. [provided by RefSeq, Jul 2008] CIViC Summary for BTG2 Gene

Forensic Context

A study in mice demonstrated that the BTG2 mRNA levels were significantly higher in ante-mortem contused skin compared to control and postmortem-injured skin, with increased levels detectable until 48 hours after death [Dong et al. DOI:10.1016/j.forsciint.2019.109937]. A study in domestic swine demonstrated that the BTG2 gene, associated with arrhythmia, exhibited further repression at the mature mRNA level compared to its nascent transcript signal following myocardial infarction, as validated by quantitative polymerase chain reaction [Kaikkonen et al. DOI:10.1161/CIRCGENETICS.117.001702].