Basic Information

Symbol
C1QBP
RNA class
mRNA
Alias
Complement C1q Binding Protein Hyaluronan-Binding Protein 1 GC1Q-R SF2p32 GC1qR HABP1 P32 Complement Component 1 Q Subcomponent-Binding Protein, Mitochondrial Complement Component 1, Q Subcomponent Binding Protein Splicing Factor SF2-Associated Protein C1q Globular Domain-Binding Protein Mitochondrial Matrix Protein P32 ASF/SF2-Associated Protein P32 Glycoprotein GC1qBP SF2AP32 GC1QBP P33 GC1q-R Protein COXPD33 SF2P32 C1qBP
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_001212.4
Sequence length
1169.0 nt
GC content
0.5081

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-406.00 kcal/mol
Thermodynamic ensemble
Free energy: -428.53 kcal/mol
Frequency: 0.0000
Diversity: 300.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((...)))((((((((.......))))))))((((....(((.(((.(((.((...(((((((((.(((.((((....))))))).((.((((((((.((((((((.((((((((((((((((.((((((((((((((.((((....))))(((((((((((......((((((((((((((((....))))))))(((((((((((...))))))....).))))(((((((.((((.(.(((.((.((....)).)).))).).)))).)))))))((((.(.((((.(.(((...))).))))).).)))).......(((((((((..((((((...((((...))))...))))))..))....))))))).......(((((...((....)))))))..))))))))...(((.(((((((((..((....((((((..((((((.((((((.......)).)))).))))))..)))))).....)).((((((((........))))).)))....((..(((((((((....((((((....(((.........)))...)))))).(((......)))(((..(((((........)))))..)))....)))))))))..)).))))).)))).)))))).))))).)))..........)))))))...)))))..(((((((...)))))))..(((((.(((((((..((.(((((((....((..((((.....))).)..))....))))))))))))))))((.(......).)).((....))....(((((.....)))))((((.....)))).........))))))).)))))))))))))....))).))))..((((((...))))))((((((.....))))))(((((....)))))..)))).)))).)))).)).....(((((......))))).((((((((..((((.........)))))))))))).)))))))))..))))).))).)))..))))......(((((((......((((..............((((((((((.........((((((.......((((((((((((.......)))))..)))))))..)))))))))))))))))))).....))))))).
Thermodynamic Ensemble Prediction
,,,...|||((((((((.,....,)))))))),,,|}},|({,.({{.{{{.{{...(((((((((.((,,{{{(..,.}))}|||{({.((((((({,((({({((.{,{(((((((((((((.(({{{(((((((((.((((....))))((((((({((,{{{,{,((((((((((((((((....))))))))(((((((((((...))))))....).))))(((((((.((((.(.(((.((.((....)).)).))).).)))).))))))){((({{,((({{{.(((,..})).))}}}}).)))).......(((((((((..((((((...((({...))))...))))))..,}....))))))).......(((((...,{....,,))))).,))))))))...|{|.|,||(({{{..((....((((((..((((((.((((.{,......}).)))).))))))..)))))).....)).{(((((((.,....,.))))).)))....((,.(((((((((....(((({(.,..(((..,.,,...}}}.|.|||}}}.{{{..,,,,,}}{||,.|||{{........))))),.}},....)))))))))..)).))))).||||{|,,,))})))||||||.{{,{.....|||||||{{{||,,,..(((((((...)))))))...||}}}|((((((..((.(((((((....({.{,,{{.....,,}.,.,))....)))))))))))))))))))}},....,.{{{{{...,))...,,}}}}}}}}}),}})||||,....}}},...||....},))})).))))))))))))).,,,|||.}}})))}|{{{(...,}}}},((((((.....))))))}||,|.,,.}))))}}))))})))).))}},)).,..,||{,({{{{{{|,||,{((,((((,.....,..}}}}.))).)),)))))))})))))))))..}}}}}.)}}.,}),.))}}......(((((((......((((,.............((((((((((.........((((((.,.....{(((((((((((.......))))),.}))))))}.)))))))))))))))))))).....))))))).

Transcripts

ID Sequence Length GC content
GCUUCCGGCGGCGCCUCAGGUCGCGGGGCGCCUAGGCCUGGGUUGUCCU… 1169 nt 0.5081
Summary

The human complement subcomponent C1q associates with C1r and C1s in order to yield the first component of the serum complement system. The protein encoded by this gene is known to bind to the globular heads of C1q molecules and inhibit C1 activation. This protein has also been identified as the p32 subunit of pre-mRNA splicing factor SF2, as well as a hyaluronic acid-binding protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the C1QBP (C1QBP) exhibited stable expression at 2 and 14 days post-injury but was significantly downregulated at 60 days post-injury following controlled cortical impact, as part of a cluster of genes associated with complement activation and apoptosis [Izzy et al. DOI:10.3389/fncel.2019.00307].