| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUUCCGGCGGCGCCUCAGGUCGCGGGGCGCCUAGGCCUGGGUUGUCCU… | 1169 nt | 0.5081 |
The human complement subcomponent C1q associates with C1r and C1s in order to yield the first component of the serum complement system. The protein encoded by this gene is known to bind to the globular heads of C1q molecules and inhibit C1 activation. This protein has also been identified as the p32 subunit of pre-mRNA splicing factor SF2, as well as a hyaluronic acid-binding protein. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the C1QBP (C1QBP) exhibited stable expression at 2 and 14 days post-injury but was significantly downregulated at 60 days post-injury following controlled cortical impact, as part of a cluster of genes associated with complement activation and apoptosis [Izzy et al. DOI:10.3389/fncel.2019.00307].