| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCGGCAGCGCAGCAGGAGGGAGGCGCGAGGCAGGAGCCGGCGGCUG… | 1527 nt | 0.7138 |
Predicted to enable signaling receptor binding activity. Predicted to be involved in locomotory behavior. Predicted to act upstream of or within maintenance of synapse structure; motor learning; and neuron remodeling. Predicted to be located in several cellular components, including climbing fiber; extracellular region; and presynapse. Predicted to be part of collagen trimer. Predicted to be active in cerebellar climbing fiber to Purkinje cell synapse and synaptic cleft. [provided by Alliance of Genome Resources, Apr 2025]
A study in Wistar-albino rats demonstrated that a gene interaction network, including C1ql2, Cbnl, Sdc1, Bdnf, MMP9, and Cd47, was relevant following mild traumatic brain injury, with the C1QL1 being highly expressed in the central nervous system and mentioned in the introduction as involved in synapse regulation [Colak et al. DOI:10.1016/j.injury.2012.01.021].