Basic Information

Symbol
C1QL1
RNA class
mRNA
Alias
Complement C1q Like 1 CTRP14 C1QRF CRF C1QTNF14 C1q And Tumor Necrosis Factor-Related Protein 14 Complement Component 1, Q Subcomponent-Like 1 C1q/TNF-Related Protein 14 C1q-Related Factor Complement Component 1 Q Subcomponent-Like 1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_006688.5
Sequence length
1527.0 nt
GC content
0.7138

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-762.80 kcal/mol
Thermodynamic ensemble
Free energy: -784.78 kcal/mol
Frequency: 0.0000
Diversity: 295.97
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.(((.(((((((.((((((.((((((.((((((.(((((.(.((((((.((((.((((.....))))...)))).).))))).)))))).)).))))))).))).((((((.((((((....((((((((.....)))))))).....(((((((((((....)))).....)))).))).)))))).)))))).......(((((((.(((((..((..((((.((((.(..((((((((((((((((((.....((.(((((((((((((((..((((((((((.(..(((((.((.(((((((...(((........((((..(((....)))))))((((((.(.(((((.((((..(.(((((((..(((((((((...(((..(.(((.((((.(((((((......)))...)))))))).))))..))).))))))))).)))))))).)))).))..))))))))))(((..((((..((((((((((((((.(((((.((..((....)).))))))).)))))).))))))).)..))))..))).)))...)))))))..)).)))))..).)))))))))).....))))))))))))))))))))).)))))..((((((((((((((.(((...(((.((((.....(((((......)))))..(((...)))........((.((((((..((......)).....)))))).)).)))).)))..))).)))))))).........))))))...............((((....)))))))))))))..)))))..((.((((((((((....)))).((((((.(((((((((((.((.((((.((((...((.((.((.............)).)))).)))).))))))..))))))))))).((((((.(.(...(((((((((......)))))))))...)).).)))))((....)).............))))))..(((((..((.........))..)))))..))))))))...........))))..)).))))))))))))))))))(((((((((.......(((((.((((((.(((....(((((((((((((((((((((((((...........((((((.((........)).))))))...(((.(((((.......(((((......)))))))))).)))((((.(.((.(((......))).)).)((((((..((....))..))))))))))((((....)))).....((.(((......((........))....))).)).....)))).)))))).))))).))))))))))..((.....))((((......)))).((.(.(((((((....))))))).).))..))).)))))).)))))(((((((((........))))).))))....).)))))))).)))))))...))).)))................................
Thermodynamic Ensemble Prediction
.(((.(((.(((((((.((((((,((((((.((((((.(((((.(.((((((.((((.((((.....))))...)))).))))))).)))))).)).))))))).))}.((((((.((((((..,.((((((((.....)))))))).,...(((((((((({....}))).....)))).))).)))))).)))))).......{((((((,(((((,,({..({((.({{{.,|,((((((((((((((((((..,,.((.(((((((((((((((..(((((((((({({.((((((((.(((((((...(((........((((..(((....)))))))((((((.(.(((((.((((..(.(((((((..(((((((((...(((..(.(((.((((.((((((,.,....},,,}.)))))))).))))..))).))))))))).)))))))).)))).))..)))}))))))(((..((((..((((((((((((((.(((((.((,.((....)).))))))).)))))).))))))).)..))))..))).)))...))))))).}))})))))})),)))))))))).....))))))))))))))))))))).)))))..((((((((((((((.{{{...{((,((((((...(((((......)))))..}}}}}..,,..,..|||({.({((({..{{......)).....})))}).})})))).)))},}}}.}}}}}))}.........))))))...............((((....)))))))))))))}.})))},,{{.{{((((((((....)))).((((((.(((((((((((.{,.((((.((((...((.((.((...........}.)}.)))).)))).)))))}..))))))))))).((((({.{.{...(((((((((......)))))))))...}}.}.)))))((....))..........,,.))))))..((({{,,{{.........)).}))))}..)))))))),,,,,,.....}}}}..}}.}}})}))))))}}}}})|(((((((((.......(((((.((((((.((({{{{((,((((((,{((((((((((((((.....,,....((((((.((........)).))))))...({{.((({{.....,{(((((......)))))))))}.|||((({.({(,.(({......)))...,{((({,,...|,}}}})..))),,)))))|,,,....,}},.....((.({(......{{........))..}.})),},.....)))).)))))).)))))}))))))))))..((.....))((((......)))).((.(.(((((((....))))))).).)}..))).)))))).)))))(((((((((........))))).)))}....)))))))))),)))))))...))).)))....,,,........,,,..............

Transcripts

ID Sequence Length GC content
AGUCCGGCAGCGCAGCAGGAGGGAGGCGCGAGGCAGGAGCCGGCGGCUG… 1527 nt 0.7138
Summary

Predicted to enable signaling receptor binding activity. Predicted to be involved in locomotory behavior. Predicted to act upstream of or within maintenance of synapse structure; motor learning; and neuron remodeling. Predicted to be located in several cellular components, including climbing fiber; extracellular region; and presynapse. Predicted to be part of collagen trimer. Predicted to be active in cerebellar climbing fiber to Purkinje cell synapse and synaptic cleft. [provided by Alliance of Genome Resources, Apr 2025]

Forensic Context

A study in Wistar-albino rats demonstrated that a gene interaction network, including C1ql2, Cbnl, Sdc1, Bdnf, MMP9, and Cd47, was relevant following mild traumatic brain injury, with the C1QL1 being highly expressed in the central nervous system and mentioned in the introduction as involved in synapse regulation [Colak et al. DOI:10.1016/j.injury.2012.01.021].