Basic Information

Symbol
C3
RNA class
mRNA
Alias
Complement C3 CPAMD1 ARMD9 C3a C3b C3 And PZP-Like Alpha-2-Macroglobulin Domain-Containing Protein 1 Complement Component C3a Complement Component C3b Complement Component 3 C3a Anaphylatoxin Prepro-C3 Epididymis Secretory Sperm Binding Protein Li 62p Acylation-Stimulating Protein Cleavage Product HEL-S-62p AHUS5 ASP
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Chronological age estimation

MANE select

Transcript ID
NM_000064.4
Sequence length
5231.0 nt
GC content
0.5645

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1926.50 kcal/mol
Thermodynamic ensemble
Free energy: -2017.07 kcal/mol
Frequency: 0.0000
Diversity: 1156.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......((...(.((((((.((((.((..((((((((((((..((.((((((((((((((((((......((((.(.((((((((.((.((....)).......(((........)))...(((((.((...(((........))).))))))).......)))))))).)).)))))...)))))))))))).)))....((((.(((.((((..((..(((((..(.((((((..((..(((....((........)))))..))..)))))).).))))).))...)))))))..(((......)))....))))...........(((........)))))).)).))))))...))))))...........((((((.((..(((((((((...(((.....)))...)))))))))))))))))((((((...)))))).....(((((((((..(((........)))...((((((((((..(((((((((.((((((((((((((((..((((............))))....))))))(((((((....((((((..((((((....((((((.((((((((((.((..((.(((...)))...))..)).)))))))..))).).)))))..))))))...)).))))....))))).))))))))))))((((((((((((((((.....(((((.(((((((.((((........)))).))))).)).)))))...))))).....))))))))).)).............(((((...(((.(..(((((.((((((((.(((.......))).)))))))).))).))..)))).))))))))))))))...((((((((((.((...))))))))))))((((((.(((((((((((....((((((.(((.(((.((......)))))))).))))))((((......))))...((((.(((((.(..(((((.....)))))).)))))...)))))))))))))))))))))...(((((((.((((((((..(((......))))))))..)))))))))))))).))).))).(((((...((((((((((.(((((((((((..(((...(((((......)).))).....((.(((((((...((....)).))))))).)).......(((((.((((..(((((.......(((((((((((((((((((...((((.((.(((((((((...((((((((((((((.(((((...(((.(((((...........(((((....(((((((..(((((.((((.(...(.((.(((.(((.((...((.((((((((..((............))..))))))))))...((..(((((((...((((.......((((..((((((.((((...)))).)))...)))..))))..(((.......)))...((((....).)))))))....)))))))..))..)).)))))).)).).).)))))))...))..))))))).))))).....((((...)))).)))))..)))...))))).).(((((.(((((((((..((((((((((((((.......((((((....((((.(((((((((.....))))).......))))))))...)))))))))))))(((.((.....)).)))(((.(((...))))))((.((((((..((((((((((....((.(((.(((....))).))).))...)))).((((......(.(((((........))))).).......))))(((((((.(((.((((((.........((.((((((((((........))..........(.((((......)))).)..(((..(((((....(((((((((((.(..((((.....))))..).)....)))))))))))))))..)))(((.....))).))))))))))..)))))).)))))))))).(.(((((.........))))).).)))))).)))))))).(((..(((((((.....)))))))..))).))))))).....))).)))))))).)))(((.((....)))))(((.(..((((..(((.(((((((......))))))).)))....))))..).))).))))))))))))).))))).))))...))))))))))))))))((((((............(((((....)))))..((.((((((((....)).))))))))((((.....))))((((....)))).)))))).......((.((((((....(((.(((((.....))))).)))..)))))).)).((.(((....)))))........(((((.(((.(.(((((.............)))))).))).)))))..))))).))))......))))).))))..)))))....)))..))))))).))))..)).......)))))))).(((.((((((...((......))))))))..))).((((.((((((((...))).)))))))))......((((((((((((.........)).)))))...).))))(((((((..(((((.....)))))..))..)))))..(((((((((....(((...((((.((......(((.((((................(((.(((((.(.(((((...(((((((..((((((.....((....(((((((.((((.((.((.(....))).)).))))....((.((((...(((((((.(((.(((.((((.((((.(((.((..(((........(((((..........)))))(((((((((.(((((.....)))))))....))).))))............)))..)).))))))))))).)))....)))..)))))))...)))))).........)))))))..)).....))))))...)))))))..))).)).).))))).))))))))))..)).))))...)))......)))))))))))))).......(((..(((((((((.......))))).))))..)))...)))))))))..)).)))).)))))).)...))...((((((((((..((((((....(((....(((((..(((((((..((((...))))((...((((((((..((((((((.....)))....((((...((((.((.((..(((((((((((((....))))))).((((((((((.((((((((..((((...((((.(..(.(((((((.(((((((((((((.....(((..(((((((..(..((....)).)..)))))))..)))(((.(.(((((((((((..((((((.......))))))..))))))...............(((..((((((((....(((((.((((.(((...(((((((((((..(((.(((((.((((((.(((((..(((((((((.(((..((..........((((....))))))..)))..........................(((((.(((((..((.......))..)))))))).)))))))))))....)))))))))))..))))).))).....((((..............))))((((((((.(((((..((((..(((.(((.((((((.(((.........((.(((((.........))))).))..........)))))))))))).))).)))).(((........))).))))).)))(((((((.(((......))))))))))....(((((((...(((....))).)))))))..(((.....)))(((((.((((........)))).)).))))))))..((((......)))).....((((..((((..........)))).))))...)))))))))))...))).)))).)))))....)))))))).....)))...((((........((((..(((((.((((((....)))))).)).....)))..))))......((((((((((...........((((....))))...........((.(((((..((((........(((((((.((..............(((((((((((((((.(((((((((.((....)).)).......((((((((...))))))))...(((((((..(((((((.(((((..((((((((.(((.((((.(........).))))..))).).)))))....)).....))))))))))))...(((....)))......))))))).))))))))).)))))))).......)))))((((((((((((....((((((.....(((......)))))))))....)).))))).))))).((((....))))....)).))).))))....))))..))))).)).((((((.........))))))..((((.....))))..(((((((((.(((.......((((.(((((.......)))))))))..((((((...(((.(((((((((((....((((((......)))).))...))))).)).)))).))).........)))))).((((((((.((.........)))))))))).))).)))))))))((((((((.(((......)))..)))).)))))))))..)))))..)))).)))))).)))..))))))).......))))))....((((((((((((((((........)).))))...((((.(((((((((.(....).)))))))))..))))....)))))......)))))......))))))).)..)...))))..))))..))))...))))))).)))))...)).........))))))..)).)).))))))))..)))))..))))))))..))))))))).......................(((...(((((.(((....))).)))))...)))..(((((((..((((....((((((.(((((.......)))))..))).)))))))...))))))).....)))))...)))....)))))).)))).)))))).((((((......))))))....
Thermodynamic Ensemble Prediction
.......,{...,.((((((.((((,((..{(((((((((((..((,((,(((((((((((((((..,...((((.(.((((((((.((.((....)).......,,,.{,,,,,.,}}...{||||,|{...(((........))).}}}}}}}.......)))))))).)).))))).,.)))))))))))).}||,,{.(,.(.((,{((((..((..(((((..{.((((((..((..(((....((........)))))..))..)))))).}.))))).))...)))))))..{{,......)))}}..||||.......,}.{(((........))))}}.},.)))))}..,)))))}..........,{(((((.((,.(((((((((...(((.....)))...)))))))))))})))))((((((...)))))).....(((((((((....{,,{{{{..|||.,,((,((((((({,(({((((((.((((((((((((((((..((((............))))....))))))(((((((....((((({..((((((....((((((.((((((((((.((..((.({{...))}...))..)).)))))))..))).)}}))))..))))))...)).))))....))))).))))))))))))(((((((((((,,,((,,,..(((((.(((((((.((((........)))).))))).)).)))))...,)),,.},}.))))))))).))....,}}},,..,(((((...(((.{..(((((.((((((((.(((.......))).)))))))).))).))..}))).))))))|||||}}}{{(((((((((((.((...))))))))))}}|{|||||{,||||||(((....{(((((.(((.((,{({....,.)))))))).)))))}||||}}}..}))))},.((((.(((((.(..(((((.....)))))).)))))...))))))))||)}.)))}}}}}...(((((({{((((((({,,(((......))))))))..)))))))))),.||{|||{||{,{,|(({||(((((((({{.({(((((((((.,{(({{...((({{{...|....((((,..{((....,),))))}...,..)))))),})),.,....((((({((((..(((((....{{{(((((((((((((((((({..,((((.{{.(((((((((...(((((((((((({(.(((((...(((.(((((...........(((((....(((((((..(((((.((((,{..,(.((.(((.(({,|{||.{(.((((((((..((............))..))))))))}}...{{..{((((((...{{{,.......,{((..,{{((,.((((...)))),))).,})),...((((,{,|,,.....}}}....||},}..|||..}}}}.,.,))}}})).,)),.,|,}}}}}}.}}.,.,.))))})),..))..))))))).))))).....((((...)))).)))))..)))...))))).).(((((.(((((((((..((((((((((((((.......((((((....((({{((((({((,.,...,}}},,..}}.,))))))))...)))))))))))))(((.{(.,,,.)}.))|({(,({{..,}})})),{.((((((..((((((((((....((.(((.(((....))).))).))...)))).((((..,.,.(.(((((........))))).}....,..))))(((((((.(((.((((({....,....{{.{(((((((((......,.||......,,,.(.((((......)))).).,(((.{(((((,...{((((((((({.(..((((.....))))..).,....))))))))))))))),.))){((.....))),))))))))))..)))))).)))))))))).{.(((((.........))))).}.)))))).)))))))}.{{{..{((((((.....)))))))..))).)))))))..,..))),,)))))))},)){{(,((,,..|}|}}(((,({,({{(,(({(,({{{{||,,,,,.})))))),))),,,,))))..),))}.,)))))))))))).))))).))))...,,))))))))))))))||||,...........,.(((((....))))).,{(,({(((((({,..||||||||}||((((.....))))}||{}}}.,.||{||,},|,,{.,,.,,,|{||||,...|||,|{{{|,,,,.)}))),))),})}}}}}.|}.({.(((,...|||}}........,{{({.{{{,|.{{{{{.,,,.,.......})})),.}}}.)))}}..}}})),)))}},,}}.))))).)))).,)))))....|,|,|))))))).)})).,))....,,.)))))))).{{,.{(((((...{{......)})))))},,}}}.{,,{.,,{{(((({,..,)))))))))))..,,}}(((({((((({{.........)).)))))...}.)))){((((((..(((((.....)))))..))..))))}{{(((((((((....{{{,{,((((.({...,,,(((.((((................(((.(((((.(.(((((...(((((((,.((((((...,...,,(((((((((.((((.((.(,,{....))},)),)}}|{{{,...,,||}},{((((((.(((.(((.((({,((((.(((.((..(((.,{.,..,|,{({....,|}..,|}|||(((((((((.(((((.....)))))))....))).)))).,.....,,,..)))..)).))))))))))).)))....)))..))))))),,{|||,...}}},.,,,))))))}.))}.},..)))))).,.)))))))..))).)).).))))).))))))))))..)).)))).},)))....,,}))))))))))}},.......(((,{((((,{{{{,,,...}))))),))))},),,...)))))))))..)).)))).)))))).}...}|,,.,(((((((((..((((((..,{((({{..{({{(.,(((({...,|{{(.,{{{{{{,...((((((((..((((((((.....)))...,((((...((((.((.((..(((((((((((((....))))))).(((((({((({((((,,((..((((.,{((((.(..(.(((((((.(((((((((((((....,(((,.{,(((((,{{..{,....||{|..,}))))),,)))|||.{.{((((((((((,.((((((.......)))))).,))))))...............(({.,((((((((...{((({(.((((.(((.,.(((((((((((..((({..(((.((((.(((.((((,(((((((((.(((.,({..........((((....))))}}..)))........,.......,,.,......(((((.(((((..((.......))..)))))))).))))))))))).((((((.((({,,,.....(((((((..((.((((({.........,{({{((({{{.|,,,{{{,,{{{(({.,,(.,,({((,((((({{..........,.,||||}}}}},}.}))),,.,).,,,..,},.,)}})))))))},)}),,))))))...))..))))))),,...{|,(((((((.(((......)))))))))).,,.(((((((,,,({{..,,)}}.)))))))..}))).))))))..,,..,{||.........))))).))).))))))}((((......))))......{,,..((({..{,......)))).))))...))))))))))).,.))).)))),}))))....)))))))}.,.,,||}...(|((...,....((((..(((((.((((({....}))))).)}....})))..)))).....,|,,{{{{{((||.........((((....))))...........{(.(((((..((((........(((((((.((....,.........{((((((((((((((.(((((((,{,((....)).||,,.....{(((((({...)))))))),,}{((((((..(((((((.(((((.,,,(((((,.(((.((((.(........).))))..))).}.)))))....,,.....))))))))))))...(((....)))......))))))}.))))))))),}))))))}......,))))|((((((((((((....((((((.....{{,......)},))))))....)),})))).))))),((((....))))....}}.)))}})))....))))..))))).)}.((((((.........))))))..((((.....))))..(((((((((.(((,,.,...((((.(((((.......))))))))}..((((((.,,(((.(((((((((((....((((((......)))).))...))))).))}}})).}}),,.,,....)))))).((((((({{((.........)))))))))).))).))))))))){{{(((((.(((......)))..)))))})))}}}))},)))}),.}}}).)))))),))},.))))))).......))))))...,((((((((((((((((........)).))))..,((((.((((((({(,{....,.))))))))}..)))}.,..)))))......}})))......})))))).)..)...))))..)),)}}),,)}..)))}})).))}))}.})).........))))))..)).)).)))))))).,)))))..))))))))..|||||,},}..,,}....,}}}}..........((((((((((..{,...,{......))...,))))))))))...,,((....((((((.(((((.......)))))..))).)))}}})}..))))))}.....,,|||...,))....)))))).)))).,}))))}{{|||,...,..,}}}}).,..

Transcripts

ID Sequence Length GC content
ACUCCUCCCCAUCCUCUCCCUCUGUCCCUCUGUCCCUCUGACCCUGCAC… 5231 nt 0.5645
Summary

Complement component C3 plays a central role in the activation of complement system. Its activation is required for both classical and alternative complement activation pathways. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that form the mature protein, which is then further processed to generate numerous peptide products. The C3a peptide, also known as the C3a anaphylatoxin, modulates inflammation and possesses antimicrobial activity. Mutations in this gene are associated with atypical hemolytic uremic syndrome and age-related macular degeneration in human patients. [provided by RefSeq, Nov 2015]

Forensic Context

A study in humans demonstrated that the C3 is part of a six-protein panel with predictive value for sudden cardiac death risk in patients with hypertrophic cardiomyopathy, as identified using UPLC-MS/MS [Raluca-Maria Cătinas et al. DOI:10.3390/ijms26146818]. Furthermore, proteomic analysis of human blood plasma showed that the C3 is upregulated with age and contributes to age-predictive models, with proteins yielding an R² of 0.59 and a combined protein-miRNA model achieving an R² of 0.70 [Salignon et al. DOI:10.18632/aging.204787].