Basic Information

Symbol
C4B
RNA class
mRNA
Alias
Complement C4B (Chido/Rodgers Blood Group) CPAMD3 CO4 C4B1 C4B3 C4F CH C3 And PZP-Like Alpha-2-Macroglobulin Domain-Containing Protein 3 Complement Component 4B (Chido Blood Group) Complement C4B (Chido Blood Group) Basic Complement C4 Complement C4-B Complement Component 4B Chido Form Of C4 Complement C4B1a EC 2.1.1.144 EC 2.7.11 C4B12 C4B_2 C4B2 C4B5 C4BD
Location (GRCh38)
6:32014730-32035973
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis Postmortem interval inference
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001002029.4
Sequence length
5427.0 nt
GC content
0.5836

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2177.50 kcal/mol
Thermodynamic ensemble
Free energy: -2270.95 kcal/mol
Frequency: 0.0000
Diversity: 1956.70
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((..((((.(((......((((((((......))))))))((((((((((.((((((...((((((..((((((((((((.((((((.((.........)).))))))...((..((((((((.((((((((..(.(((.(((((.((((((((((.......)))))....))))).))))).)))).))))).(((((.((((.(((((((.((((((..(...(((((((....(((.((((...((((.(((((.((.(((((........(((((.....))).))..(((((((((...(((((((.((((((((((((((((.((.(((((((((.(((......((((((.....))))))......))).))))....((((((((((...((((.....))))..................((((((((((((((...........((((((((((........)))....((......))........))))))).)))))))).))))))(((((..(((((.((..((.....))..)).)))))..))).)).....))))))))))(((....)))))))))).)))))..(((((((.((((.((....)))))).)...)))))).((((.((...)).))))....(((((....(((..((.((((((.(.(((.(((.((.((((((((((((((((...((..(((..((..((((.....((.((((.........))))))........(((((...))))).))))...))........)))..))..)))))))))).))).))).))..))))))).)))))))).))).(((((..((((.(((((((((.(..........).))))))...)))))))))))).))))).............)))))))))))..(((.(((((.((..((((.((...(((((((((((........((((....(((((((((((((....))))))...)))......((((((.((((((((.....(((((((.(........).))))))).(((((((.((.((((.(((((((..((((((((.(((...((((...........))))...))).))))))))((((((((((....(((((((...........(((((.(((.........))).))))))))))))..)))))).)))).))))))).))..(((((....)))))..((((((....((((((((((((((..((((((..((((((((...))).)))))......))))))((((.((((..((((..................(((((((....((.(((((....))))).))..)))).)))((((....(((.((.((..(((((((((.(((((((((((((((((((((((((((...((((((((......((((..((((((((((..((..((((((((.(((..........))).)))..)))))((((((..((((((((((((((((((((((.(....((((((((....((....))..))))))))....)))).)))))...))).(((((........))))).((((((.(((......)))..)))))).............))))))..))))).))))))...((((((((.((......))))).).))))..(((((.((((((.((.((........)).))..)))))).)))))(((((......)))))))....))))))))).)..))))....))))))))..(((((.(((((....)).))))))))....((((.(.((.(((((...))))))).)...)))).....((((........)))).(((((.....((((......))))..))))).))))....)))))))))))))).)..)))).....((....))..)))).)))))))))..)).))))))))).....((((.....))))......))))..)))))))).)))))))))))..))).......))))))..............)).)))))))))......)))))))))))))).((((.(((((..(.((((((((.(.(.((((.((.(.((.(((((((.((.....)).)).).)))))).))).))))).)))))))))))).))).)))).(((((...(((((((((.....(((((..((...))..)))))...)))).))))))))))(((((((((((((.((..(((((((..........((((((((..(((....(((.(((......))))))...)))))))))))(((((......)))))((((((((..........))))))))............(((.((((((((..(((((.((...)).))))).....((((((((..(((((((.......((((.......))))..............(((((((((((((((((((((...(((((..(((((((....(((.((((.(((((((...(((((((.((.(((((((.(((.((.....(((.(((((....((......))....))))).))).....)).))).))))))))))))))))))))))).)))).)))...)))))))..))))).)).)))))).))(((((((...(((((((((((((.(((...)))((((((((((...........))))))))))...((.((((((...(((.((((((((.....((...))....))))))))...)))...)))))).))..))))))))))).))(((((((..............)))))))...))))))).....)).))))))))).......((((......(((.((((((((.((.((.....)))).)))))))).).))......))))..))))))).)))))))).(((((((((((((......((((((...))))))....)))))))))))))(((..((((((((((..(((((.((...........)))).))).))))))))))..))).(((((...((.(((..(((((.((((((((.(((((((...(((.(.(((.((((.(((.........)))))))..)))).)))....))))))).)))))).)))))))..)))..))...))))).))))).))).)))((.((((((..((((((.....))))))..)))))).)).))))).))..)).))))))))))))).....))))..))))........)))).))))))))).)))).)))))))..)))(((.((((((((((((((.((((....((((((..(((((.(((((...((((((.((((((((.(.((((...(((((.....))))))))).)...))))))))(((((((..(((.....(((((.((.(((.(((((......((...(((((((....)))).)))....))...........((((.((....(((..((((((((........))))).)))..)))...((((((...(((.((((((.((((...(((((((((((.((((((((((((((....)))).)))))...)))..)).((((....)))).......)))))..))))))..)))).))....)))).)))..)))))))).))))....)))))...))).)))))))))).))).))))..(((....))).(((((.......)))))))))))))))).))))).))))))..))))..((((((..(((....((((((((((((....)))))).........(((((((...((((.(((.(((((((..((.......)).))).)))).))))))))))))))))))))..)))..)))))).............))))))))))))...)).)))..((((((...(((..((...((((.......))))))..))).))))))....((((.......))))))))))))))))).)))))))).))))))).)))).)).)).)))..))))))).........)..)))))).))))...)))))))))))).....(((((((.((.(..(....)..).)))))))))......((((...(.(.((((....((..(((((......)))))...)).......)))).).)...))))))).)))).))))..))......))))).)))))))))))))..)))))))))).(((((((((((((((((((((((((((((((((((..((((((((.((((.((..((((((.(.(((.......))).((((((((........))))))))(.((((.((((........)))))))).).).))))))..)).)))).)))))))).)))).)))(((((...))))).......((((........))))..)))))))).........(((.(((((((..(((((((((((.(((((((..((.(((((.(((((.((((..((((.(((.((((((.(((.....((.((((((((..((((.(((..(((((...))))).))).))))...)))))))).)).......(((((((((((((...))))))))...))))).....((((...(((((((.((((((((...)))....)))))))))))).....))))(((((......)))))))).))).))).))).)))).)))).))).))..)))))...))..)))))))......(((((((.((((......)))))))).))).....((((..(((.(((.((((.((.((((....)))).))....)))).))))))..))))......(((((...........)))))(((.(((((..((...((((((((..(...((((((((((((((..............)))).))))).))))).)..))))))))))..))))).))))))))).))).))..))))))))))....(((((....))))).)))))))))))).....(((...(((((.(((...((..((((....))))..))))).))))).)))(((((..((((...((.....))...))))..))))).))))))))((((((.(.(((.....(((((((.......)))))))..))).)))))))..........))))))....)))))))..))(((..(((..((((.((((.......)))).........(((......)))...))))..)))..))).
Thermodynamic Ensemble Prediction
....(((((((({(((,,,(,.((((((((......)))))))),,(((((,,,.|||||,...((((((.,((((((((,(({.(({,,,.,,.........,),,))}))}}}||}|(((((((({(((,,,,,..(.(((.((((({((({((((((.......))))).,.,,)))),))))).))),,)))))}|||,|}|{,.((((,,,..,,||||((({......})))........||||||{((({((,.,|(({({,,,,}}}},,,.,{{{.,...((((((..,..,,,{,,}}}}|}.(((((((((((..(((.(.(((((((.,.((((((.............)))))),.(((((((((({,{((((......)))))})))...)))).)))((((......)))).......,(({{....})))))))))).).)))...})))))))))}......(((((((,..((.(((((.......((((((({(((((((.(({.{(((((((((((((((({({,{.,{,{({,,..,.|||||||{{{{{({...,|{||}|||(((..{.,,,..},.}))})),,,,((((((.{(({(,{|....))}),}.)}).)))))).((((.((...)).)))).....,}}.)))))}}))))))))||{,{,,|{.,{(|{{{(((((((((,(((((({{,{{,.,{{,..({{({{,..,|.||}|,,{.........||||||......,.||{||...}))}}.|{((..{{{{..{{{{,||,{{||.{|||||||,||,.}}.}},.{{{,{{,,|,,.,|,.}}|},}}....,|,,||||..,||{{|||({(({({{({{{{.{||||||{{{|||{|||,||,|{{{{.{{{..,,..}}},))))))}})))|(((((.((((({{{,.,{||}|{,.,((,,,,,{|||..,,,,,{{{{{...,|{||,,{((((((....))))))}..|||,.....||||....|||||}}}}},,(((((((,,........),,)))))).,|.,{,{({(((({{..{{||||,,((((((((.(((...((((...........))))...))).))))))))|{{|,{{{|,..,,}|))))}}}.}}}..}}}|||,,.,||}}}},..,,)))}))))))}}))))))),)))))),,)})),,))))))..|||{|,,,}}||||..((((((....((((((((((((((..(((((({,((({{(((,,,))}.}}}}}......))))))((((,((((..((((.....,,...........(((((((....((.(((((....))))).))..)))).))}{{{{,..{(({{((.((..(((((((((.((((((({{((((((((((((((((({.{{((((((((......((((..((((((((((,.||||((((((((,(({.|,...,}..))).)))..))))}((((((..(((((((((((...{(((({{{.,....((((((((.,.,((...})).,))))))))....,}}}.))))}.,...(((({{{..,,|..,})))},((((((.((({.....))}..))))))..,,.........))))))..}}))).))))))...((((,,{|}||,,..{{|},}}.)}))))..(((((.((((((.((.((........)).))..)))))).)))))(((((......)))))))...,))))))))).)..))))....))))))))|.(((((.(((((....)).)))))))),,..((((.{.((,(((({...}))))}},)}..)))).....((((........)))).(((((.....((((......))))..))))).)))),,,.)))))))))))))).}..)))).....((....)).,)))).)))))))))..}}.))))})}}}.....{(({.....)))},,,.,.))))..)))))))).))))))))))}.,))).......)))}}).}},...,.,...}))),)))..)))},,,)))))).}}.,},)))}}}}}.,,))}.,}}|))}||)))}}|}}}||.}}...}}))}}).,..,,.{{{{||{||{,.||||||((,,.))))).))).}}})|,}},}}}}})))}||,||..))))||})))))}..{(((({{.....{{{{,|.....,.)))){(((|,|({{(((((((({{((....)}))))((((..((((((.((((((((..(((....(((.(((......))))))...)))))))))))(((((......)))))((((((((.....{.(((((((..(((,...,)))....)))}.)))}}.}))))).......))))))..)))}.,))))).})))))))....{{{{{(((({..{{{{|,||..{{{(({(((((({{(((((,((({(((({{(({{{{((,,{{{((((,((({.,(({,.(((((({(({{,.{({((({{.{(,(((((({.(((,((.....,{(.(((({....{(......}}....})))).)}},....}),))}.||||||}|)}}|)))}|||}||||||||.|||{{.||||||},,}},))}})}})})},.)))){(({{,{{,((((((((((((.((({{{||{((((((((((...........)))))))))|{{(((...}}}}}}.,{({(,,,)))},.|}},||},||,,||}|)}})}}...|})}}})}}.))})},,{{...,.,|))}|,||||||{.,..,.,,....|,|||,,,,}}|}}|},}},||,}||,..,,}},||||.||||{{|,,,....,{{.((((((((.|(.{{.....}))}.)))))))),,,,|{{{{{{{{.{{,.,|},..}...,))|))}||||((((((({.,....{({(((...)))))),,,,||}||}}}})))}|||,}||((((((({..((({{.{{......,....)))}.))).)))))))))}..|||{{{({{..,{{.(((..(((((.((((((((.(((((((...(((.{.(((.((((.(((....,,,..}))))))..)))).)))....))))))).)))))).)))))))..))).,|},|,}||||,||||{{,,{{(({(..((((...}))),,,}))))),||||||||,|,,,||||||||{||.{||,|||}|,||,||||.,...}},)}))})},.}}}.,}),))))))),,}||{|,}}.|||||,,|||||||||}}||{{{{((((((.(((,..,.{{(({(..(((((.(((((...((((((.((((((((.,.((((...(((((,...,)))))}}}),),..))))))))(((((((,,((({,,,,(((((,((.(((.{{(((......||.((((,((((....))))))))....}},..}}},,,,,}|||||.{,..(((..((((((((........))))).)))..)))...{{{(((,..{((,{(((,,.{{{{...{((((({((({.,,|||||||(((((....)))),,))))..|}|,..})}|{{{....}}}}.,....,|}}},..))}})),,)))}.})},..)))).))}..)))))),..,},.}}})))))),|,)),.)))})))},}.....|||..,))}.,}))))}(((((.......))))))))))))))}},|||}},|||}||..||||{,((((((..(((....((((((((((((....)))))).........(((((((...(((,,(((.(((((((..{(.......}}.))).)))).))))))))))))))))))))..)))..))))))|,,,...,.,||.})}}}}|||||}...,,,)})}}}||,||}|.|||{{{|||||||||....||||||.,,,||||{|||,..,..{{|||,,.,,,.}))})))}.))}}}})}))}))),..}||||}},,}}}.}..,..}}}},}}|})))|||...},,}..|||,,,,}||,..|||||||,}}}}}.....(((((((.((.{..{....)..}.))))))))).,,,.,,|,|..,,,|,,{||...}||..{((((......))))),..}}...},,}))}}.},}},,}},,,}),,}},,)}))}}))}},,.,))}}}.})))),}))}})}},))}})))))),}|.,{||||||||}|||}||||||||}||||,{||},||||||||,||||}||,,||||||||}{|.|||||.,},|.((((((((........))))))))|}||||,,{||..}}}}}})))}}}||{|...))))})}}))}}},),)))}||||.|||}.,,}|((((...))))||||||||(({{,|||||.((((,.(({{({({{{.....,}.))}),...}))}..))))((((((.((((((((.,...........((.((((..{(((.(((.((((({,(((...,,({.((((((((..((((.(((.,(((((...))))).))).))))...)))))))).,}.,,....(((((((((((((...))))))))...})))).....{{{{.,.(((((((.((((((((...}}}....)))))))))))),...,}}}}(((((......)))))))).))}.))),))),)))).)))).)})))))))).))..)))}.||||.....}}}}}})))||,||,{|,||||||}}}}}}}})}|||||||||.,(({{(({{{{({{(.((((...)))))))},.{{{((.{(,{{{{|,.{{{{{,|,,.{|||||,.,,,,.,,.}))}}|,,.,||||{{{{,..,,|||,,}},}...{{{{{{{{{({(((..............)))))))})).)))},.,......))))).,,))))).)).))))),.,,|.|,.,||}|||||}..,,,(((((..,,}))))..(((...((((((....(((...(((((.(((...((..((((....))))..))))).))))).)))..|.))))))...))}.,}}}}},))).}}.,||||||,,}}))))||(((({.{((((...}||||,||}},..,,)}))))),,))).,))))))},.,|,,|,|||}|||..,,,.{{{||||}||,,,,,,}).}}}}}}}}})))..,,)),)}}}}...}})))}}}))}}})))}.|||{{.,,.)))),

Transcripts

ID Sequence Length GC content
NM_001002029.4 NCBI
AGAAGGUAGCAGACAGACAGACGGAUCUAACCUCUCUUGGAUCCUCCAG… 5427 nt 0.5836
Summary

This gene encodes the basic form of complement factor 4, and together with the C4A gene, is part of the classical activation pathway. The protein is expressed as a single chain precursor which is proteolytically cleaved into a trimer of alpha, beta, and gamma chains prior to secretion. The trimer provides a surface for interaction between the antigen-antibody complex and other complement components. The alpha chain may be cleaved to release C4 anaphylatoxin, a mediator of local inflammation. Deficiency of this protein is associated with systemic lupus erythematosus. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. Varying haplotypes of this gene cluster exist, such that individuals may have 1, 2, or 3 copies of this gene. In addition, this gene exists as a long form and a short form due to the presence or absence of a 6.4 kb endogenous HERV-K retrovirus in intron 9. [provided by RefSeq, May 2020]

Forensic Context

A study in humans identified the C4B as a gene with expression levels pleiotropically associated with sepsis through Summary data-based Mendelian randomization analysis [Yang et al. DOI:10.1111/jcmm.18559]. Another human study found the C4B was upregulated as part of complement cascade activation in the kidneys of patients who succumbed to septic shock [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in mice demonstrated that the C4B transcript, a complement system protein, increased in relative abundance within one hour postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267]. This finding was part of a broader investigation into postmortem transcriptome dynamics, which identified 1063 genes with significantly increased transcript levels after death in zebrafish and mouse, suggesting a step-wise shutdown process.