Basic Information

Symbol
C5AR1
RNA class
mRNA
Alias
Complement C5a Receptor 1 C5AR CD88 C5R1 C5A C5a Anaphylatoxin Chemotactic Receptor 1 Complement Component 5a Receptor 1 C5a-R Complement Component 5 Receptor 1 (C5a Ligand) C5a Anaphylatoxin Chemotactic Receptor C5a Anaphylatoxin Receptor CD88 Antigen C5a Ligand C5aR
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mechanical injury analysis

MANE select

Transcript ID
NM_001736.4
Sequence length
2324.0 nt
GC content
0.5112

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-767.10 kcal/mol
Thermodynamic ensemble
Free energy: -808.03 kcal/mol
Frequency: 0.0000
Diversity: 559.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((.((((((((((((((..((((..(.(((((.............((((((((((.....(((((((.((((...(((((...(((((.....(((((..((((..............))))..).)))))))))..)))))((((.((((.((((.(((((((((...(..(((((((((((((((((......(((((((((((((..((.....))..)))...))))))))))..(((....)))........(((((....)))))..........))))))))))).))))))..)...)))...)))))).)).)).))))..))))..(((((((((......((((....)))).........)))))).))).....(((((((((....((...(((((.......).))))...))....))))))))).......)))))))))))......))..))))).)))..((((((((.((((.(.(((((((((.((((((...))))))..))).........((((((((.(.(((....)))).)))))))).......((((...))))(((((((((.((.....))))))).)))))))))).).)))).))).)))))..)))))))))))))))))))))))).))((((.......(((((.(((..((((((..........((((((....))))))....(((((....)))))....((((((.(((((((((((((((((.(((((((((............))))))))))).(((((....(((((((....)))))))))))).)))))))....))))))(((.(((........))).))).....)).))))))((..(((((((((((..(((((........(((((((....))))))).(((((..((...))..))))).....(((......)))(((((((..((.((((((((((.((((..((((.(((((.....((.......))..))))).))))..)))).))))).((((((..((((.....(((((((.((((....)))))))((((((...))))))..))))......))))..))))))(((.((((..((.((((((.((((..((....)).)))).((((((((((...(((((((..((((.(((((.(((.(((((..((((((((...........(((((((.((((.(((.((((.(......).))))))).............(((((....)))))............(((....((((((.........(((((((((((((.....)))).))...........)))))))((((.((....)).))))))))))....))).........(((......)))..)))).))))))).....((((((....))))))..)))))))))))))))).)))))))))....((((.....))))((((.........))))..)))))))....(((((........))))).................(((((.(.((((....)))).))))))...((((((....))))))))))))))))))))))..))..))))...)))))))).))..))))))).))))))))))..........((((.......))))..........)))))).)).(((((((.((((.....((((......(((((((((.((((.(((.....))).....(((.((((((((.(((((((((((.(((((....((((((((((......))))).....((((((((..(((((((((..((((((.....(((((((((.(((.....(((((.....)))))...)))..)))))))))......))))))...)))))))((((((((..((...........))..))))))))...(((((..(....)..))))).))..)))))))).(((((.(((.((((((....(((((...)))))........)))))).))).)))))...)))))..))).)))).).......))))))))(((((((...)))).))).....)))))))).))))))).)))))...))))......))))....)))).))))))).((((((...((((((((...........))))))))..))))))...........))))))..))).)))))........(((((.......)))))...))))...............)))))).
Thermodynamic Ensemble Prediction
...{((({(((,(((((((((((((,.,((((..,.{((((.............(((((((({{.....(((((((.((((...(((((...(((((.....((((,..{(((,,.......,,,..}}}}..}.)))))))))..)))))((((.((((.((((.(((((((((...{..(((((((((((((((((..{{,,{(({(((({({{{..{((,,,|}|.,|||...}))}))}))),,)}|.,..(({,...,,..{|||{,,.,))))}..........))))))))))).))))))..}...)))...)))))).)).)).))))..))))...,(((((((..{,..{{{{,...)))),........,,,}}}.,,....|.(((((((((....((...(((({.......}.))))...))....))))))))).......)))))))))))......},..))))).)))..{(((((((.((((,(.(((((((({.,(((({...||}},}..))},.,....,,(((({{(({(.(((....))),))))))))).......((((...)))){((((((((.((.....))))))),}))})))))).).)))).))).)))))..))))),)))))))))))))))))|,||{{{{.....,.(((((.(((..((((((.{((((((.((((..(((((({(.(((((((((((.,.{((.({{{{{,{{,,,.,,,(((((((((((((({((((((((({{{{{{{,.,.,|||||,,,,..}|||||.},.(((({{,,,{{|||||,,,,,)),,,)))))),,})),,}.,{{.{,,..,}}}}})))})),,....||{|||}|,....,||,||||,..,}}}}}}}..,..,,|||||||....,))))))}})(((.(((((((..((((({.(((.(((......))).))),,{{{...))}..(((((.((((..((((.(((((....,{,.......))..))))).))))..)))).)))))...))))).)))).))).))).||{.{(((....)))))}),)))).)))))))}).)))))).........((((((..(((..((((((.,{{({.,,(({,..,,},}})}.}}}}.{(((((((((...,,,,,,...((((.(((((.(((.(((((..((((((((......,{,..(((((((.((((,(((.((((.(......).))))))).............(((((....)))))............(((....((((((......,,((((((((.,,{((.....,,.,||}.......,,,.}))))))},,,.{{...,)).}),.))))))....))).........,{{......}}}},}))).)))))))..}}}{(((((....))))))..)))))))))))))))).))))))))).{((((((,{{{{|,||(((,...,,,,..||,,.,{((|||,,}}.||{|{,,......)))}},,{{{........,,,,|((((,{,({{{....)))).})))))...||||||,,,,))))))))))))))))|{{{,..}))}})))}.))))))....}))...))))))..)))).))))))},{{.{{.{{{,.......,,,,........,,,|||.{(((.(((((((.((((.....((((......(((((((((.((((.(((.....))).....(((.((((((((.{((((((((((.{{(((....((((((((((......)))))...,.((((((((..{{(((((((..((((((.,,..(((((((((.{{(.....(((((.....)))))...}))..)))))))))...,,.))))))...)))))))|(((((((..((...........))..)))))))}...(((((..{....)..))))),,,..)))))))).(((((.(((.((((((....(((((...)))))........)))))).))).)))))...)))))..))).}})).,.......)))))))}(((((((...)))).))).....)))))))).))))))).)))))...))))......))))....)))).))))))).,||||,,||{{{(((,{.,,{{{....||||}},}}|},})))),,.,},,,,..))))))..))).)))))........(((((.......)))))...))))...............,))}}}.

Transcripts

ID Sequence Length GC content
ACCUUCGAUCCUCGGGGAGCCCAGGAGACCAGAACAUGGACUCCUUCAA… 2324 nt 0.5112
Summary

Enables G protein-coupled receptor activity and complement component C5a receptor activity. Involved in several processes, including complement component C5a signaling pathway; mRNA transcription by RNA polymerase II; and positive regulation of ERK1 and ERK2 cascade. Located in apical part of cell and basolateral plasma membrane. Biomarker of Alzheimer's disease; asthma; chronic obstructive pulmonary disease; rhinitis; and severe acute respiratory syndrome. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in rats demonstrated that the C5AR1 was significantly upregulated after spinal cord injury, with mRNA and protein expression peaking at 4 days post-injury and being primarily localized to neurons and astrocytes [Li et al. DOI:10.4103/1673-5374.255994]. In a mouse model of traumatic brain injury, spatial transcriptomics identified the C5AR1 as a disease-associated microglia marker, showing specific upregulation in the injury hotspot at 7 days post-injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528]. A study in rats demonstrated that the C5AR1 gene, part of the complement cascade, was upregulated in the spinal cord injury epicenter at 7 days post-contusion [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042]. In human forensic research, the C5AR1 mRNA marker (C5AR1) exhibited a blood-specific expression pattern and was stably detectable in 13–16-year-old blood stains from large (~0.75 cm²) stains with 100% reproducibility between individuals, though it failed to amplify from small (~0.05 cm²) stains [Zubakov et al. DOI:10.1007/s00414-008-0249-z].