| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCUUCGAUCCUCGGGGAGCCCAGGAGACCAGAACAUGGACUCCUUCAA… | 2324 nt | 0.5112 |
Enables G protein-coupled receptor activity and complement component C5a receptor activity. Involved in several processes, including complement component C5a signaling pathway; mRNA transcription by RNA polymerase II; and positive regulation of ERK1 and ERK2 cascade. Located in apical part of cell and basolateral plasma membrane. Biomarker of Alzheimer's disease; asthma; chronic obstructive pulmonary disease; rhinitis; and severe acute respiratory syndrome. [provided by Alliance of Genome Resources, Jul 2025]
A study in rats demonstrated that the C5AR1 was significantly upregulated after spinal cord injury, with mRNA and protein expression peaking at 4 days post-injury and being primarily localized to neurons and astrocytes [Li et al. DOI:10.4103/1673-5374.255994]. In a mouse model of traumatic brain injury, spatial transcriptomics identified the C5AR1 as a disease-associated microglia marker, showing specific upregulation in the injury hotspot at 7 days post-injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528]. A study in rats demonstrated that the C5AR1 gene, part of the complement cascade, was upregulated in the spinal cord injury epicenter at 7 days post-contusion [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042]. In human forensic research, the C5AR1 mRNA marker (C5AR1) exhibited a blood-specific expression pattern and was stably detectable in 13–16-year-old blood stains from large (~0.75 cm²) stains with 100% reproducibility between individuals, though it failed to amplify from small (~0.05 cm²) stains [Zubakov et al. DOI:10.1007/s00414-008-0249-z].