Basic Information

Symbol
C7
RNA class
mRNA
Alias
Complement C7 Complement Component C7 Complement Component 7
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_000587.4
Sequence length
5716.0 nt
GC content
0.4361

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1754.84 kcal/mol
Thermodynamic ensemble
Free energy: -1863.17 kcal/mol
Frequency: 0.0000
Diversity: 1681.64
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((....(((((((((((((.(((((...)))))...)))))....((((((......(((......((((((........)))))).....)))......))))))(((((.((((((((.....)))..)))))))))).((((......((((((((((...((((((((.((.((((((((.((((((.(((((((.(((.(......)))).)))).))).......)))))).................((((((((((...((((((......))))))....)))).))).)))((((((.((.((((((...((((....))))......)))))).)).)))))))))))))).)).)))))))).(((((((.....(((((..(((((..((((((..((((((((.((...(((((....((((((((.((((((..((.((.....))))(((((((((((((.(((((((((..((((((((((.(((......((((((((((((((....((.(((((..((((((......))).)).)..)))))..))..(((..((((((((.((.....)).))))))).)..)))......))).)))).))))).))....))).)).)))(((((.((((...(((.(((((.........((((((((((((..(((((.......)))))..))))).......)))))))...(((((...)))))....))))).)))....)))).))))))))))..))))))))).)).)))))).)))))))))))))))))))..))))))).))))))))..(((.....))).......((((.....))))))))))...))))))))))((((((((((................................)))))))))))))))))))))))))))....)))))))))))).....(((((((((((((((((((((((.(((((.....((((((((.((..((....(((((...((((.(((.(((((.((((((..........)))))).....((((((((........))))))))...((........))...(((((((.(((((((((((.......(((((((((....(((..((((((...............((((...))))..((((((((.((((...((..((((.(((.(.....))))(((.(((((((.(((((((.(((((......(.(((((.(((.((...(((.(((...))).))))).)))..))))).).(((((((....))))))).(((((((...........)))))))......)))))....(((((((........)))))))..))))))).).))))))))).......)))).))...)))).)))))))).)))))).)))))))))))).........))))))))).(((..(((((((((...))))))))).....)))((((.(((((.(((((((....((((((.......)))))).(((((.((......((((((((((((((...(((((((((((.((((((((((((((((((((((..(((((....((((.......)))).......))))).)))).....)))))..(((((((((....))))))))).....(((((((.....)))).))).............(((((((((((.(..((((((..((.((((.....)))).)).))))))))))))))))))..))))))....))))))).))).))))))))((((((.((.....)).)))))).............))))))))))))))........)).)))))((.((((((.(((...))).)))))).))...)))))))))))))))).)).)))))))...((((.(((((((((.(((..(((((((.....((..(((((((..(((((.((........)))))))(((((((...........((((.(((.....))))))))))))))(((((((..((..(.(((((((((...((((((((....(((((((((.(.(((((((........)))))))).)))).....)))))...((((((...................)))))).((((((..........)))))).........(((..........)))(((((((........)))))))..))))))))...))))....))))))..))..)).)))))...))))))).)).)))))))(((((((((((.(...((((((((.((..((((((..((((((..(((...(((((((((....)).)))))))...(((....))).)))..))))))..)))))))).)))))))).((((((.(((((((..(((..(((.(((((((.((..((...(((((..(((((.(((((.........(((((((((.((.....((.((((((..((.((.((.((((((.......)))))).)).))(((((((((...)).)))))))...((((((((....)))))))).((....)).))..))))))...(((((((((..(((((((.((...))))))))).)))))))))..))....)).))))))))).(((((((((((................)))))))))))))))).))))).)))))..)).....((((...((((.(((((......(((..((((((((((((..((.......((((((((((....(((.((((((((((((((...((....)).)))).))))))))))....(((((((((.((((((((((...((((((((((...........)))))))))))).)))))))).((((((((...)))))))).((.(((((((.((((((............(((....))).(((((.((((((......(((.(((((...((.........))...))))).)))...)))))))))))((((.(((........)))...))))))))))...))))))).))......(((((((.......)))))))..(((((((.....((((((...((........))..))))))..((.((((((((((((((.((.((((..((((((((...))))))))(((((((.(((((.((((.((((((....)))))).))))...)))))...))))))).((((.....))))..(((((((((((((...(((((((......((((.....))))...))))))).((((((((.......)))))))).((.((((.((.((((((((..((((.(((((..(((((..(((..((....))(((......))).(((((......)))))...((((((.(((((.((...((((((.(((........))).))))))....(((.((((...........((((..........)))))))))))..))))).)).)))))).................(.((((((((((((((((((((.(((((...)))))..)))))).....)))))(((((((((.......))))))))).....(((((((...)))))))((((((.(((...........((.((((((((((((.((((...))))))))))....)))))).))........................(((((((((.((((((((((((((.(((((.((((..(.........(((((((((((((((((.....((((((..............))))))..........(((((.......)))))(((((((.(((.((........................)).))).)))))))...(((((.....(((((((.((((((...((((.((((.((((....))))..))))))))...))).))).))))))))))))(((((..((((...((((((.(((((((((((.((((((....(((.(((((((((.(((((((((.((((((((.......(((((((((((....((((.....)))).((((........))))))).)))).)))).....))))))))((((((............)))))).....))))...)))).).)))).)))))))).)))))).)))))).)))))..))))))...)))).)))))..........(((((((((..(((....))))))))))))..)))))))))))))((.(((((..(((.(((((...)))))))).))))).))...((((((.((.((.............)).)).))))))))))...........(((........))))..))))..)))))))))))))..)).)))).)))))))))(((((......)))))))).))))))..))))))))).).)))..)))))..))))).))))...(((((((.....(((((((.........((((((...))))))......))))))).......)))))))...(((((.....((((....((...((.(((((........))))).))..))...))))......))))))))))))).)).)))).))((((((((((......))))))))))((((...(((((.......)))))...)))).....))).)))))..)))))(((((((......)))))))........)))).)).)))))))))))))).)).)))))))......((.((((((((((.((((..(....)..)))).))))).((.(((((..((((((..(((..(((((....)))))..((((((((((((((((((..(((((..(((...((..(((....)))..))))).......(((((((.((((((((.((.....))))))))))(((((..(((.(((((.(((....))...((((.((((..............)).))))))).))))))))..)))))((((.((((((((((.((((((((....))).))))).))..)))))))))))).((((...)))))))))))...)))))...)))))))))..))))....))))).....(((((((...............))))))))))..))))))..)))))))))))).))...)))).))))))))..))))))))))))..)))).)))))))).)))......)))))))))..))))...(((((.(((((((..(((..(....)..)))))))))).))).))...(((((((....)))))))........(((((...)))))....)).)))))))))).)))..))))))).))))))).)))))))))))...((((((((((.(((..(((........)))..))).))))))))))........)))))))))..)))))))..)))).).))).))))...)))))))..)).)))))))).....)).)))..))))))............)))))))..)))))).))))....((((......)))).)))..
Thermodynamic Ensemble Prediction
.(((((,((((((((((((((.(((((...}))))...))))},({{{..........,}}}.......(((((,...,})))),,))}}})))))||..{{({{{.,,,|}}}}|,(((((((,..|||,,.}}}},,|((((((..,.,..((((.((((..{((((((((.(((((.((((((.((((((.(((((((.(((.(......)))),)))).))).......)))))).((((((.((((((...(((.(((((((((..(((((((.((((.....(((((({..{(((.(((((((.((.((((((...((((....))))......)))))).)).)))))))}))).,}{{{.{((((((({,,,{{{{|||||||||,|}|{{(({,(((({{..{({{((((,((,,,(((((,{,,(({{((((.((((({..,,{({,.{{{||{.(((((((((((((.(((((((((.,((((({{{{,.,{{..,,,,({{((({(((((((.,..{,.(((((,..(((({....,{}}|{|,.|,.||},}..,)}.,||}}|||||{{,.||,,...,),)))))))}).,))),,..,})})}}})|,|||||{||...,,||{||{||,,,,,,.||||}}}|,|.|||||}}.,,,...((((((((((((..(((((.......)))))..))))).......)))))))...,((({,..,}})).},.}}|||,,}}....,,,),),)))))))).,))))))))).)).)))))).)))))))))))}}))))}}..))))))),)}}}}}))..{((.....))}.,,,{{,.{{{,,...}}}}})}}}|,,,}|}}}.,|,|{(((((((((........,,..,,.....,,,.},,......)))))))))))}}|||,({{{{{|,,,(((((((((.(((((.(((({.,,{(((((.(((.....,(((.(((((((..{{((,.......)))}....))}}})))})},(((((...(((({{{((((,(,,,..,|}||||}.,.,,((((({{,.....}),))))}}}},,,}}.,.,,,.,)},.))))..))))).))).)))))}.|}}|||,...{{{,(,,,{(,({,.,,|,.{{..{{{{{..,.((({...}))),..|||}|...})|,,..,.,}}..}}}}}}||,...,,,,})}})))))))))))))),||||}}},{{{{,.(((((.(((.((...(((.(((...))).))))).)))..)))))}}}||{((((,,..)))))}}.(((((((...........))))))).......{{{|....,,,{{,{.,.}}}}((({{(((.....)))).}))),,,||,,....,,..|||,,,,{{||{|{||||,{(,((((,|{{{{{.,.{{(({(..,.{{{...,,,}}|,..}}}}},,,,,||)}}}))})))).)).))))).)}}}}},{|{||{|||{{{||,.((((((.,....})))))).{||||.|||,||,,((((({{{((({,{{{,(((((((((((.((((((((((((((((((({{({{{(((({,.,{{,{,..,,}})))),......}},},.}}}|,,...||,},..(((((((((....))))))))).....(((((((.....)))).)))...|||..,...,((((((((((((,...(((((..((.((((.....)))).)).))))))))))})))))))..))))))....))))))).))).)))))))){||||,.{{,,,.,}}.})))}}.,,,,,,{{|,.,}||||||}}})))),...},},,}||}}}|||,|||||{||||,.,}}),}}||||{,..,|)}}}|||({|,{{{({(,....}}||||,|||||..{{((({...,(((,{..,.,,..,.}}}((((((.(({{(,,,....,,)).))).)))))),{{{{,|,,},,..,{{,((((.(((.....))))))))))}}}|{{,.,(({,,{|||.||{{{({(({,.{{{{{{{(||{,(((((((((.(.(((((((........)))))))).)))),,.,,}}}}}..,|((({{||..........,,.,}..))))))}|{((({,......,..))))}}||||,.,,|||,,,...,....,}|||||{{{.....}},}}}))}},.))))}})),,,}..{,|.|,|,{{(,.,.||,}|||.}||.}}||}}}.||}}}}}}||||,.,|||...,|||{.{{{{{{{{.{|.,(((({{..{{{{({.,{,....(((((({({{{,,}}.}}}}})),|,|.|{||{,,,..)))}})})))..)))))))).))))))}}.}}}}((((((..{.((((({....}).))))}....))))))(((((..(((((.(((((.........{((((((((.((...,.,{.((((((..((..,,((|{{{{{{..,,},.})}|||{|,.}},|||||((({{{{...))))))}..((((((({....)))))))).||....}}.))..))))))...(((((((((..(((((({,((...))))))))).)))))))))..}}....)).))))))))}.{((((((((((.,,..........,..))))))))))}))))).))))).))))).}}),,,)}}}}....|||,|}}}}}}})))))}}..}}}}},,,,,|...,|}},,,.))))))......{((((......)))))..)))).)))))))))))))))).)))....,....((((...)))),,)))))).)))))).,{,,,........,,,...))))))..))))).))))))))})))}.)))),,,.,,,}}}}}}}.,{{,.,||||{((((({(((((,,{..{{{{({{{{,.....,,({(((((((({((({......,......{((((((({((,..{(((((((((((...((((({(({{,..,.........,.}}..,,..........,.,{{{,....(((({(((......)))))))..{((((({.....{(((((...{{.....,,,,,..))))))..{{.((((((((((((((,{{,{{{{..{(((((((,..}}}||}}}(((((((.(((((.((((.((((((....)))))),))))...)))))...))))))).||||.|||,|||||,(((({((((((((,,.(((((((......((((.....))))...))))))).((((((((.......)))))))){(({((((,((.((((((((,,((((.(((((..(((((..(((..((,...}}{((.,....}}}.(((((......)))))...((((((.(((((.((.{.((((((.(((........))).)))))).,..{(,{((((...........((((........,.))))))))))}..))))).)).)))))).,,..............(.((((((((((((((((((((.(((((...)))))..)))))).....)))))(((((((((.......))))))))).....{((((((...))))))}((((((.(((...,,......((.((((((((((((.((((...))))))))))....)))))).))....,,,,,....||,....,...(((((((((.((((({((((((((.(((((.(((({.{........{((({,{(((((((((((,,...((((((..,...........))))))...||{{,,,{((({.......)))}|(((((((.(((.{{.....................,,.}).))).)))))))}..{,,,,..,,.(((((((.((((((...{(({.{{||.((((....))))..,}}}}}))...))).))).))))))},,||,(((((..((((...((((((.(((((((((((.((((((....(((.(((((((((.(((((((((.((((((((.......{((((((((((,...,{{{.,...}}}}.,|||........}}})))).))))}}))),,...)))))))}{(((((.,,.........)))))).,}}.))))...)))).).)))).)))))))).)))))).)))))).)))))..))))))...)))).)))))..........(((((((((.,(((....))})))))))))..)))))))))))))||}(((((..(((.(((((...)))))))).))))),||...((((((.,,{(({..,..........)})).))))))..)),...,,....,((......,,,))},})))))..)))))))))))))..)}.)))).))))))))){{{((......))))}))).))))))..))))))))).).)))..)))))..))))).)))).},(((((({...,.(((((((.,.......(((({{...}}})))...,,.))})))),,,.,..))))))).,.((((({{{..((((.,{{({(..((.(((((........))))).))..}.,,,))))..}..,})))))))))))).)).}}||,,|((((((((((......))))))))))||||||,|||||,,.....,}|||,..,}}}..,,.))).))))),.,))))|{{{{{{.,|,.,|}}}}}}...,,..,}))).,,.)))))))))))))).),.))))))){{(((({.((((((((,,,{((({,,(((,....,{{{|||||{||||(((((..((((((..(({..(((((....)))))..(((((((({(((((((((..(((((,.{{{.,,((..(((....)))..))))}.......(((((({.((((((((.{,.....,})))))))){((((.,(((.(((((.{((...,)).,.{{{{.{{||.....,,.......,,.}))))},.))))))))..)))))((((.((((((((((.((((({{{....)}}.))))).))..)))))))))))).((({...})))}))))))..,)))))...)))))))))..))))....))))).,,..,,{{((,....},}}.,,....}},,,..}))..))))))..)))}},,,{||,}}})))},,.}}}}|||||{.|.({{{{|,..)))))).,.)))))))})))...)))))))).))))))).....(((((.((((({,.{(((..(,...),.))))}))))).))).))...(((((((....))))))).}}},}}))))))}})))))))))}.}})),)))))))}{{|..,,,.}}}{((({{.......)))))},,..}}}||||||}}|||..((({..,.{{,,,.,})}),.))))||||,,,,.,.}))}.,,,.,,},...{(((..(((((((......)))))))..)))}{{{{{..{|,,{{{....))),.))..))))}},,,},,,},}}}}}||||{{||.{|||},..,,,}},}))),),}))),)))..

Transcripts

ID Sequence Length GC content
AGGGAGAGGCAGAGAGGCAGGCAGCCUGCUGGGCUCUUCCUGCUGUUGA… 5716 nt 0.4361
Summary

This gene encodes a serum glycoprotein that forms a membrane attack complex together with complement components C5b, C6, C8, and C9 as part of the terminal complement pathway of the innate immune system. The protein encoded by this gene contains a cholesterol-dependent cytolysin/membrane attack complex/perforin-like (CDC/MACPF) domain and belongs to a large family of structurally related molecules that form pores involved in host immunity and bacterial pathogenesis. This protein initiates membrane attack complex formation by binding the C5b-C6 subcomplex and inserts into the phospholipid bilayer, serving as a membrane anchor. Mutations in this gene are associated with a rare disorder called C7 deficiency. [provided by RefSeq, Nov 2016]

Forensic Context

A study in mice demonstrated that the C7 transcript, a pore-forming protein involved in immunity, increased in relative abundance within one hour postmortem and exhibited a profile with two distinct maxima over the postmortem interval [Pozhitkov et al. DOI:10.1098/rsob.160267].