| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCACGCAGGGGAAGAGAAAGCAGGAGCCGUCCAGCACGGAGGAAGGCGA… | 1721 nt | 0.4294 |
Carbonic anhydrase III (CAIII) is a member of a multigene family (at least six separate genes are known) that encodes carbonic anhydrase isozymes. These carbonic anhydrases are a class of metalloenzymes that catalyze the reversible hydration of carbon dioxide and are differentially expressed in a number of cell types. The expression of the CA3 gene is strictly tissue specific and present at high levels in skeletal muscle and much lower levels in cardiac and smooth muscle. A proportion of carriers of Duchenne muscle dystrophy have a higher CA3 level than normal. The gene spans 10.3 kb and contains seven exons and six introns. [provided by RefSeq, Oct 2008]
A study in mice demonstrated that carbonic anhydrase 3 (Car3) gene expression was commonly down-regulated in liver tissue following specific in vivo α-particle irradiation of Kupffer and endothelial cells, as part of a broader inflammatory response and characteristic suppression of antioxidant and metabolic genes [Roudkenar et al. DOI:10.1269/jrr.07078].