Basic Information

Symbol
CA3
RNA class
mRNA
Alias
Carbonic Anhydrase 3 CAIII Car3 Carbonic Anhydrase III, Muscle Specific Carbonate Dehydratase III Carbonic Anhydrase III EC 4.2.1.1 CA-III Epididymis Secretory Sperm Binding Protein Li 167mP Carbonic Anhydrase IIII HEL-S-167mP
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005181.4
Sequence length
1721.0 nt
GC content
0.4294

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-501.60 kcal/mol
Thermodynamic ensemble
Free energy: -533.18 kcal/mol
Frequency: 0.0000
Diversity: 461.68
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((.(((((((((((...((..((.((((((((((((((((((.(((..(((..((((((((((((((((.(((((.((.((...((((((.((..((((((.............))))))..))((((((((((((((..((((.((((((((((...(((.(((..((((......(((.(.((((((((((....(((((((((((((((...)))...)))))).......)))))).((((((.((....(((((....)))))...)).))))))...........(((((((.......))))))).((((...(.(((((.........))))).)....))))..))))))))))).))).....))))..))).))).))))))))))((.(((((....(((((....))))).(((((.....)))))....))))))).....))))(((((...))))).))))))))...)))))).....)))))).)).)).))))))))))))....)))))))..))..)))................(((((.(((((..(.(((....)))...)..)).))))))))..((((((....))))))....(((.....)))((((((.((((.((.((.(((.(((((........))))).))).)))).)))).))))))....((((.((((.((.((....)).)))))))))).)))))))))...)))))).).))).))))(((((..(((....)))..))))).....((((((((((.........((((.(((....))).))))......)))))).))))....((((((((((((.(((((((..(((....(((.((((((((((.((((.......(((.(.......).))).((((((.(((((((......(((.((...((((((((((..((((.(((...((((((........(((((((((.......)))))))))))))))....)))...))))..))))))))))(((((.((((.....(((((((.(((((...((((.(((.((.(((..(((((.........))))).((((((((.......(((((.....(((((((...(((....))).))).)))).....)))))...........(((((.(((..................)))))))))))))))).......))).)).))).)))).))))).))))))))))).)))))...................))))).....)))))))..)))))).)))))))))))))).......((((.........))))..(((((((..(((((.....)))))..)))).)))((((((....))))))(((((((((..(((((((((((....((((((((((((((((....)))))))))))..)))))....)))))).)))))....)))))))))....)))..)))..))))))).)))))).))))))..................))...))))))))))).))..................((((((...(((.....))).))))))(((..((..((((((.((.(((((....(((((........)))))...)).......))).)).)))))).))...)))....................
Thermodynamic Ensemble Prediction
{({.(((((((((((...{{..((.(((((((((((((((((,{(((..(((..((((((((((((((((.(((((((({((.(((((((..((..((((((.............)))))).,))((,...||.(((((..((({.((((((((((...(((.{((,,((((......{{{.{.{{{|||||||,}}}||||,.,(((((((({{.||||.||}||||{.,,.....||,..((((((.({....(((((....)))))...}).))))))....,,,,,,,(((((((.......))))))).{{{{...(.(((((.........))))).),,,,)))),})})),))))}}.)))}.,,,)))}..}}}.))).))))))))))((.(((((....(((((....))))).(((((.....)))))....))))))).....)})}}}}}}})))))).)))))))))}..||||{{,....,}}}}|,|,.}}}))}}})))))))....)))))))..))..)))................((((,,(((((.{,.{{{....,})..,).})).)))))))){,((((((....))))))...,(((.....)))((((((.((((.((.((.(((.(((((......,.))))).))).)))).)))).))))))....((((.((((.{(.((....)).)))))))))).))))})))),,.)))))).),})).))))((((({,(((....)))}.})))).,,..((((((((({.,{,.....{(((.(((....))).)))}....}))))))).)))),,..((((((((((((,(((((((..(((....(((,{(({{({{{.|{{||,,,,..{((({({{{..{,{,,,..(((({(,((((((({{....,,|,|,,,,|{((((((((.,((({.(((...((((({.......,(((((((((.......)))))))))))))))....)))..,)))}..))))))))}|,((((((((.....{(.(((((.,,,,,...,((,{(,,.,|},}}..,||,,..,}},)}.}},))))))))||||||||,.{{{{{.....,,{{(((.,.|||,..})))})))},,,,.,,{,}}|||..,{{{|{..((((({{(((.{{..........}.},.))))))))).,,||||,......||}}}}...|(((((.,.,.)})))||||||{{{...)))))),.,............}}},),,,,.,}}}}))..}})))}.)}}))}}}}))))}.......,{{|,.....,,,},,,..{((,(((,.(((((.....})))),.)))).)))((((((....)))))){((((((((..(((((((((((.,,.((((((((((((((((....)))))))))))..))))),}..)))))).)))))....)))))))))....}}}..))).,))))))).)))))))))))))...,,,....,....,,.}}...))))))))))).}},.,,,.............((((((,..(((.....))),))))))(((..,,..((((((.((.((({{....{{{({........}}}}}...)),......))).)).)))))).)),..))}.............}))....

Transcripts

ID Sequence Length GC content
CCACGCAGGGGAAGAGAAAGCAGGAGCCGUCCAGCACGGAGGAAGGCGA… 1721 nt 0.4294
Summary

Carbonic anhydrase III (CAIII) is a member of a multigene family (at least six separate genes are known) that encodes carbonic anhydrase isozymes. These carbonic anhydrases are a class of metalloenzymes that catalyze the reversible hydration of carbon dioxide and are differentially expressed in a number of cell types. The expression of the CA3 gene is strictly tissue specific and present at high levels in skeletal muscle and much lower levels in cardiac and smooth muscle. A proportion of carriers of Duchenne muscle dystrophy have a higher CA3 level than normal. The gene spans 10.3 kb and contains seven exons and six introns. [provided by RefSeq, Oct 2008]

Forensic Context

A study in mice demonstrated that carbonic anhydrase 3 (Car3) gene expression was commonly down-regulated in liver tissue following specific in vivo α-particle irradiation of Kupffer and endothelial cells, as part of a broader inflammatory response and characteristic suppression of antioxidant and metabolic genes [Roudkenar et al. DOI:10.1269/jrr.07078].