Basic Information

Symbol
CACNA2D3
RNA class
mRNA
Alias
Calcium Voltage-Gated Channel Auxiliary Subunit Alpha2delta 3 Voltage-Dependent Calcium Channel Subunit Alpha-2/Delta-3 Alpha2delta-3 HSA272268 Calcium Channel, Voltage-Dependent, Alpha 2/Delta Subunit 3 Voltage-Gated Calcium Channel Subunit Alpha-2/Delta-3 Calcium Channel, Voltage-Dependent, Alpha 2/Delta 3 Subunit Calcium Channel Alpha2-Delta3 Subunit
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_018398.3
Sequence length
3789.0 nt
GC content
0.4851

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1182.10 kcal/mol
Thermodynamic ensemble
Free energy: -1253.81 kcal/mol
Frequency: 0.0000
Diversity: 985.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(.((((.(((((((((((((...(((((((((.((((((((((.(.((((((.(((((((((((.((.((((((.......))).)))....)))))))))))))....(((((((((.((.......)).)))))..((((((((.(((.((((((((.((........)).)))))).))...))))))).)))))))))))))).)))))))))).((((((.(((((((.((...))))))))))))))).(((((((((.(((.......)))))))).)))).......).))).))))))....))))))).(((((((...((((....)))).(((((((((((((((((.....((..((((.....)))).........(..(((((.((.....)).)))))..)...)).....)))))))))....)))).))))(((((((((((........((((.((((...((((((.(((.(((((((.((((((...(((..(((...((......))...)))...(((((((((((...))).)))))))).............((((((..((((((.....(((((.(((((((..........))))))).)))))..................((((.(((.((((((((..(((...((((..((((..........)))).....(((...(((...(((((((((((((..(((((((..(((......(((((((.........)))))))...(((((((((.((((((.(((.....(((((......))))).((((....))))....(((.(........).))).))).)))))))))).))))).((((..(((((((((.((......(((.....)))((.((......))))...(((((.((((.(((((((((.(.......))))).))))).)))).)))))..((((.(.(((((....((((((((((....((....)).....)))))).))))((((((..((((....))))..))))))))))).)...))))..(((((((((..(((..((((((((....((....)).......(((((...((((((.....))))))....)))))))))))))...(((((((((((((.....(((.....)))...)))))))))))))..........)))..)))).)))))..)).)))))))))))))((((((((((.....(((((((((((((((...((.......(((((((......((((...((((((((((((...)))).)))).......((((.........))))((((....))))...(((((...)))))))))))))......)))))))........))...)))))).(((((((...(((.(.(((.((........)).))).).)))))))))))))).....))))).....)))))))))).)))..)))))))))))).))))))))))).)))......)).))....))))))))))).)))))))))))))..........((((.((((.((((.(((((...))))).)......(((((..(((.....))).)))))....))))))))))).)))))).)))......)))))).)).)).))))))..((((....(((((((((...((((((((...((((..........(((....)))..((((((((((..((((.(((((((((.(....(((................)))..)))))))))).((.(((((...))))).)).))))....))).)))).))).........(((((((((((.((....)).((((..(((((((.((..(.((.......)).)...))..)))))))(((.((((.((((((((((.((((............((((((((((....))))).......)))))(((.(((((((((((....(((((((..((((((.((((........)).))))))))((.(((((((........)))...(((((.((((((.........(((((((((.((..((.((...........(.((((((((((((((((.((.((((.((......)))))).))...))))).(((...)))......((((.(.((((.(((.........))).)))).).))))))))))).)))).).)).))..)))))..))))))((.(((((((..((((((......((((((...(((.(((((((..((((......))))))).))))..)))...))))))......)))))).))))))).)).((.((.(..(((((....)))))..).))))..))))))..)))))......)))).))))))))))))))))....)))).)))((((((.........((((...(((......))))))).))))))..((((.(((((.....(((((((((((((((.....)).))))(((((((...)))))))........((.(((((((((((((((((.((((((((((.....(((...........))).....)))))).)))).....))))).))))..(((.(((((....((((((((((....)))))(((((...((((....)))))))))(((((((..(((((....(((((((((..(((.(((((((..(..(((((.(......(((((..((((((((((((((((......)))))........)))))))))....)).)))))......).)).)))..)..))))))).......(((((...(((.((.(((.......))))))))..)))))....((((..((...((((((......(((.((.((((.....)))).)).))).(((........))).))))))..)).))))...................((((((...............)))).)))))..))))))))).)))))..))).))))..)))))..))))).)))..))))))))))))))))))).....))))).)))))))).)))))))).)).)))).))).....((.((..((((((((.((((((........)))))).))))))))..)).)))))).)))))))))))...)))).....)))))))))))))))))....)))).))))))...))))))))((.((((..((.(((..((......))..))).))((((.((((((((..(((((((((((.(((((.(.((...((((........)))).)).).))))))))))))).))).........)))))))).))))...)))))))))))).)))))...(((.(((((((((....(((...((((..(((((..(....(((..((((.....))))...)))....)..)))))...))))....)))..)))))))))))).))))))).....((((((((.((((.....(((((((((.((((.....))))..))).))))))....))))...)))))))).(((((.......)))))................)))))).)))).).(((..(((((((((........))))))...)))..)))................(((((((((......)))))))))...........
Thermodynamic Ensemble Prediction
{,{{(({(({{(((((((({.,.({((({((((((((((((((.,(((((({.(((((((((((.((.((((((,....}.))).)))....))))))))))))).,,.})))}|,||},|}}}}},}))})))}}..,{||{|{|.{||.||||||((.((..,,,.,.}|,||||||.||,,,|}}})))|}|}}|||||||.||{||||||,|||.{({(((.{{{{(((.((...}})))))))))))))))||,(((((.(((.......)))))))).))))}})),)))))))})))))}.,..)))|||}......,,...{(((....}}}},{{((((((((({{((((,....{{..{(((.....)))},,,......{,,((({{,{({,...}|,|||||{{{..,||.....}||})))}}....}}}}.}}},....,,|||||{,.,{,,||{{||}}}},)))}||{||,(({({{{(,,{{{{{{{.,}|.,..,,,...{{,.....||.{{({(...{((((((((({...})),}))))))}{{{,,........(((,(({{,,.{({,{{,.(((((.(((((((..........))))))).)))))...,,.}}}}.....,}}|}|},,{,.,||||(({,..{{{|{((,,..(({{..,,.....})),}.....|||,.||||...(((((((({((({,.{((((((,.(((......(((((((.,,...,}.)))))))...(((((((((.((((((.(((..{{{((({{.,}}}}),,},.((({....))))....(((.(........).))).))).)))))))))).))))).((((..(((((((({.(((.....,))}...{||{{{.{{.....,||||,..(((((.((((.(((((((((.(.....,,,)))).))))).)))).)))))..,..,.{.(((((....((((((((((....{(....}},....)))))).))))((((((..((({....})))..))))))))))).}...})))}.(((((((((..(((..((((((((...{((....)).......{{({{...((((((.....))))))....))))}))))))))...{{(((((((((((.....(((.....)))...)))))))))))}},....,,}..)))..)))).)))))..,,.,))))))))))))((((((((((.....(((((((,(((({({(((((((((((...(((((((,....{({,{{((((((((((({...}))).)))}.......((((........,))))((((....))))...,{{,...{||||||||,,,,)}}}.....||{||,.......})}},)))}}..})))}}}}}))))}})|,.))))))))...........))),),.)))),))),..,,}}}}}.....)))))))))).))).,)))))))})))}.))))))))|||.{{{{{{{((((,....{{((({|{,{{{,{((,((((.{{,}}|||||,|,,,{{{{.||{{,||{||,({({,{{|||,|{|||....{{{{,..((({{,,.||},}||||{.{{||||}}}}|||,.||},,.,.....|.,|{||||..||||||{||,,..{,,,..,,,|||||{{..,}||{{(((((({,..{{{{{..{{{.(((,.,,{{{{{((((((((((..,(((.(((((((((.,....{((................)))..,))))))))).||,|(({(,,,}}}}},)),,))}....))).)))).)))..,,,....(((((((((({.,{,...},,|{(({.,,,})}}.(((.(((.,{{{..((((.{,.....,,....,(((.((((.((((((((((.((((......,{{{,{((.,.(((((....))))}..}}}}.,))))(((.(((((((((((....(((((((..((((({,((((........)).))))))))((.((((.,{.....,..,,,...(((((.((((((.,.......((((((,,{,((..((.({..,..,,....{,((({{({{{(((((((.((.(((,{((......)))))).))...))))}.,{,...,,}}}},..(({{.{.,{{{.{{{.......,,}}}.}))).),))))))))))}.)))}...}}.}}..)))},..))))))((.{((((({,.((((((......((((((...(((.(((({{(,.((((......))))))).)))}..)))...))))))......)))))).))))))}.)).{{{{,,{..(((((....)))))..},)))},.))))))..})))),,,...)))).))))))))))))))))....)))).)))((((((..,..,...((((...{{{.,....})))))}.})))))..((((.(((((.....(((((((((((((((.....)).))))(((((((...)))))))........,{,(((((((((((((((((.((((((((((.....((({......,.,.}}).....)))))).)))).,,,,})}}}.)))},,(((.(((((....((((((((((....))))){{(((.,.(({,...,}}}}})))}(((((((..(((({..,,{((((((((..(((.(((((((..(..(((((.{......(((((..({((((((((((((((......)))))........)))))))))....}}.)))))......}.)).)))..)..))))))).,,....(((((...(((.((.(((.......))))))))..)))))....((((..((...((((((......(((.((.((((,...,)))).)).))).(((........))).))))))..)).)))).............,,,...((((((...{{{...,},...)))).)))))..))))))))),)))))..))).)))).,)))))..))))).))).,))))))))),))))))))).....))))).)))))))).))))))))},).)))).)))..(((((...((((((((.{...|.))))))))..)))))).))))...))).}.))).))})))))))))))...,}}}....})))))))})}}))))}),}..))))}..,,.,,,}))).)))}}},))}},.)).)))).}}}}|,,}}}|.|))}}.,.,}})))})))}.}||,{(((({((,{{(((,{.{,...{{{{....,,,,}})),})})}})))))))}}))),)))}...}}))))))))),,.))))}}.,},}},||||}}}))))}}}}|||.(((((((({....(((...((((..(((((..(....(((..((((.....))))...)))....)..))))).,.)))),,,.}}}..)))))))))}}|{{{{,,{{.....((((((((.,,{,.....((((((({(.((((.....)))).,,)).))))))....,}}}...)))))))).{{{{{.|,,,,,}}))}{,........,|||..}}))},,)))},,,||{}}|||{|||||,,,,,,,,))))}),..,,,..|||....,,,,........(((((((((......))))))))),,,,,,,,,..

Transcripts

ID Sequence Length GC content
GCUCCUUUUUCUGCUCCCCAAGUGAGCCGGGCGCGCGAGAGGCAGGCGG… 3789 nt 0.4851
Summary

This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human blood samples identified the CACNA2D3 as one of 19 center genes commonly differentially expressed across early-stage, middle-stage, and control groups following burn injury, indicating its association with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0].