Basic Information

Symbol
CACNB2
RNA class
mRNA
Alias
Calcium Voltage-Gated Channel Auxiliary Subunit Beta 2 CACNLB2 MYSB Voltage-Dependent L-Type Calcium Channel Subunit Beta-2 Calcium Channel, Voltage-Dependent, Beta 2 Subunit Calcium Channel Voltage-Dependent Subunit Beta 2 Lambert-Eaton Myasthenic Syndrome Antigen B CAB2 Myasthenic (Lambert-Eaton) Syndrome Antigen B CAVB2
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_201596.3
Sequence length
6129.0 nt
GC content
0.4291

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1751.00 kcal/mol
Thermodynamic ensemble
Free energy: -1869.33 kcal/mol
Frequency: 0.0000
Diversity: 1565.81
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((.((.(.((((((..(((..((((......))))((((((((.((.(((......))).(((((((((.(((((((((..((.((((((...(((((((..(((((((((...(((.(((((....((((((.(((((...((.(((.....))).))))))).))))))))))).).))..))))))).....))..)))))))......)))))).)).))).)).)))).))))))))).)).)))))))).)))..))))))))).))).....((((..(((.((((((...(.((...((((....)))).)).).)))))).)))....))))))))).)))))(((((((.((((((((((....(((((((((...((((((((.(((....)))..))))))))....(((.((((.(((((((((((((((.((.....(((((((...))))))).((((...((((((.(((...((((((.((((((((((........(((((((((((.........)).))))....(((((.((.(((((.(((((((((.(((.(((((((((((.(((...((.(((((((((((((...(((((((...(((((...((.........))..((((((((.(.((((..(((....))))))).))))))))).(((....)))...))))))))))))((((((((((.((((.((..(((..........))).(((((((......))))))).(((((((.(..(((((.((.((((........((((.(((((((((.....))).((((((................)).))))...((((.......((((((((((...(((.(((..((((.........))))))).))).(((((((...)))))))........(((....((((..................))))...))).......))))..))))))..))))..........))).))))))).....)))).)))))))..)))))).))....(((......)))...........(((...((..(((.((((((....)))).)).)))..)).))))).)))).))))......)))))).......(((((....))))).((((((((.((((((.((((...((((((.(.(((.....)))))))))).............((((((((((((((((....))......(((((..(((((((......((.(((.....(((.((.(((....))))).)))..))).))...........((((........))))....)))))))(((((((....((((((.....)))))))))))))((((.....))))((((((((((..((((.((((((..........)))).))))))..((((....((.....))......(((((.....)))))((((((((.(((...((((((((..........)))))))).)))))))))))..((((....(((((........)).)))...)))).....))))(((((((((((((..(((((((((..(((........))).))).))))))))))))))...))))))))..)))))))....((((((((.((((.(((........))).)))).))..))))))...)))))..................))).))))))))))))))).))))))((((..((((.((.......)))))).....)))).))))))))))).)))))))))).))...))).)))))))))..(((((.(((((.(...(((((((.............)))..)))).).)))))....)))))(((((...............))))).........)))))))))))...))).))))).)).)))))))))).((((((((.((.((((((....))))))......(((.....)))(((((....))))).(((((..((((((..((((.........(((((((.(((..(((.(((((((.(((.((...(((.......)))..))))).)))))))))..((((.((........)))))).(((.((((........))))...)))...........)..))))).))))).....((((.........))))......))))..)))))).....))))).....(((((....)))))((((((.((....(((.((((((((........................((((.......))))...(((((((........)))))))....((((((((........((..((((((..((((((((((.....((((((((((.....))))))))))...))))))))))))))))..)).....)))).))))..)))))))).))))).)).))))(((((.((...)))))))..)).)))))))).)))))))))).))))))....((((..((((..(((((........)))))..))))))))............))).)))))).))))((((((.((((.(((......((((((.((((............))))..))))))...(((....)))...(((.......)))...((((....))))...))).)))).)))))).)))))))))((((.((((((....)))))).))))...))))..((.(((((((.(((((((((((((......))))).....((((((((..(((((.(((((((((((((...(((.......))).))))))....((..((((((((((((.....))))))))).)))..))......................(((.((((((((..(((((...((((((((((..(((((((........((((((((((....(((....)))........((((((.((..(......)..)).)).)))).(((((.........))))).......(((((....)))))....)))))))))).....((.((((...(((...((((((.(((..((((((...))))))))))))))))))...)))).)).(((...((((.((((...((((....(((((((.(((((((((((.(((.((((((((((..(((.(...).)))))).))).))))))).)))))((((((....)))))).......)))))).)))).)))..)))))))).))))...)))......(((((((...(((((...............((((((((((..(((((..((.(((((......((((..........))))....(((.((..((((.......((((((((.((((((...(((((.(((((((((...((((..(......((((......))))((((((((((((((((((.....)))))))))))((((((((((..((((..((((((..((((....(.((((.((((..(((((((.(((((((((((((((.((((((.(..((((...))))..).))))))((((((....................)))))).............((((((((.(((((.((...(((((((((.((..(((((((..(((((...(((....(((..........))).((((.((((........))))))))................((((((.....))))))......)))...)))))))))))).)).)))))))))....)).))))).))...(((((.(((((((......(((((((..(((((((((((((........((.((..(((((....))))))).))....))))))......)))))))......))))))))))))))...)))))......(((((((....)))))))))))))....)))))))...)))))))))))))))..)))).)))))))))..)))))).((((((....................)))))).....((((((....)))))).((((((((((......))))..(((.....((((((....))))))))).((((.(((.(..((.((((.(((((((.(((...)))...)))))))..)).)).))..)))).)))).......................((((((((......))))))))...((((((....)))))))))))).))))..)))))))))).....))))))))..))))))))))))).....((((.((((((.....)))..))))))).(((.(((((........((((((((((((((((((......................((((((((...............))))))))..((((.......))))...............((((........)))).(((((((((.(((((((..(((((.(((((.....((((((((..........((((....))))..(((((((..((((.....))))......))))))).)))))).))..)))))))))).(((((....((((..(((((((((((((((((........)))))).....)).)))).(((.(((....))).))).............................(((((((((.(((.....)))))))))))).....((((((.(((.........(((...((((((.(((((((((........((((((........))))))((((.........))))..(((((((....)))))))...(((((((((.....((((((((.((((...((((((((((((...))))))......))))))......)))).))))))))...........((((........))))..)))))))))((((((((((.(.....(((((((.....(((((((.((((((....................))))))))))))).................((((.......(((((....(((((((....(((...)))....)))))))...)))))......))))..)))))))).))))))))))........(((((((((((.....)).))))))))).....))))))))).))))))))).........))))))))).)))))..))))...)))))......((((.((((((((((((.((((.(((((((.........))))))))))).)))..((((......))))...)).)))))))))))..((((......)))))))))))...))))))))))))))))))))))))))).........))))).)))......))))).)))))))))))))).....))))..)).)))...)))))..))..)))))..))))))..))))((((((.....((((......)).))....))))))))))).....)))))))(((((.(((((((.(((.....))).)))).))).)))))...)))))))...)))))))))).....))))).....))))))))..))).)))))))))))).))))))))((((((.....(((((.(((((.((((((((.((.....................)).)))))))).)).))))))))...)))))).......))))))))))))))).))....))))...)))).)))....................(((((.((((((....))))))..)))))..)))))))))....))))))))).....((((((((......)))))))).....).)))))))(((((((((((.....(((((((((((.......((((((..........))))))))))))).)))).....)))))....))))))...((((((...))))))..((((((((...............))))))))...........
Thermodynamic Ensemble Prediction
(((((((((({{{.((,,.,(((((,,((((.((,,....,.(((.((((((((,({.(((......))).(((((((((.(((((((((..((.((((((...(((((((..(((((((({.,{((({(((({...,((((((.(((((...((.(((.....))).))))))).))))))))))},}.},.}))))))),....))..)))))))......)))))).)).))).))))))).))))))))).)),))))))))}}}}},))))))))),)),.||..,||,..(((.((((((...(.,,,,.((((....)))),)).,.)))))).)))....})))))))))))}}}(((((((.((((((((((....(((((((((....(((((((.((((.(((.......))).)))).((......}).....))))))),.((((.....((((((((((({.|{((((......)))))..{(((({,..(((...(((((((.((((..((..(((((((,..{{(.,{{{{{|{,|{{,.((({(.((,((({{.(((({((({{(((.(((((((((((.(((...((.(((((((((((((...(((((((...(((((...{(,....,,..,,..{{{(((|||{,(({{..{((....)))}))}.})))))))).{{{....,)}.,.))))))))))))((((((((((.((((.((..(((.,,....,}.))).(((((((......))))))).{{(((((.(..(((((.((.((((........((((.(((((((,,,{{.,||}.(((((({{............,.)).)))),..{{{{.......{{{(({,{{,.,{({,.,{{..{{((.,.......|||||,,.,},.(((((({...})))))}....,...}|}|,,...{,.........,}}},..,,|||||,,{,|.,,,,,.)))),.))))}}.,)))}.},,},,..}))).))))))).....)))).)))))))..)))))).}}....(((......)))....{{{....}}|...{{..{{{.(((((,...,)))}.,|,}}}..)).,},)).}))).))))......))))))....,{.(((((....)))))}|(((((((.((((((.((((...{{{{{{.|.(((.....)))}}))}}}.............(((((((((((((((({{{{||....(((((((((((((((.((.....(((((.....(((.((.{{,....,}},),}}}..,|.,||......,{...((((........))))..,))}}))),((((((({,..,{((((.....)))))))))))))))))).....)))))}})))))))))))..{,||||..........}))).||,......,{{,..,((,....||......{((((.....))))}(((((((,|{((...(((((((|,....,,,..}))))))).))))))))))}...{{{{............,{{(((((((.((({,,........,(((((((((((((..(((((((((..{{(........)),.))),})))))))))))))...)))))...,)))..)))))))||((((((.((((.(((........))).)))).))..))))},....,.,.....,}})}.........))).))))))))))))))).))))))((((.,((((,{{.......}))))}.....)))).))))))),))).)))))))))).))...))).)))))))))..(((((.(({((.,...((((((,.............,}),,}))).}.}}))).},.)))))(((((...............))))).........)))))))))}|{,.}||,,}}||,||,||}},...,,.|,,|}||}}}},))})|}}}.,||}}}|,|,..((((.....)))),,||.,,,))))}..,,{,,,({((((,,{(({{.,,,,...{{{,,,,.{{({{({(.((({,(({((({(,{{{((({{.....|||{{||,,,.,,,,)))))}}((((.((........)))))).,{{.((((........}))),.,|}|{,,...{{{..,.,||((|.||}}},....,,||}}...}}},}.,}......,}}}..}}})))||,(((((((((((.(((((....)))))(((..(((((((({(((.(((((((..................}}},(((((.,..(((((((,{..(((((((,,...,..})))))).,{,{{,{(((({{....,.||..((({{|,{((((((((((.{{{,((((((((((.....)))))))))),}})))))))))}}}}))},.},.,,,.,||||,}}}.},}|.....{,((({{{..{||{.{(({...{({(((..,..}))))),.....,,....|||||}|||{.,..))},|,.}}}||....}))).))}}.}))))),,)))))))..,.)))))......((((.......)))).(((((((,,{((((.(((.....(((((........,....{{(({{.......,.,((.,,.},|{{{,,..,,}.,,})).}}}}.,.,,.)))))))))...))))))).),...)))))))((((.((((((....)))))).)))).......))))))).))).{{{{{{{{.(((((......)))))(((((.(((((...))))))))))....((((((,..,{,......,)))})),}}}..........((((((((((...}))))))))),.|||.,||,,,,,{,...,|||{||,.....{.,{{{{{.,,,)))))))})))}}}.{((((((({...,..{{{...{{{{{{{({{....|{{,,,.|||{{.,{{{{(,,,,,.,,..,..,},,)..)}.})|))}|,{{{||,........)))))}}}}},,{((((....)))}}.,..}}))))))))}}}..,.))))))))),,}}}|,,,,.,|,,..((((((...)))))).....)))))))},)..))))))))))))))...||{|{{{{{,,,..})))},,}.,,,,..,..})},))))||||,,.,||||||||,|}},.}|||,{{,(.,{{,.|,|((.,,,,,,..)}))))),))))),.})),|}|.,,.)))},,,.,)))}}}}}})))||||}.},.,,.))},)))))))..))..)))}})))))))))..,|.||}},{((((,.{((((.....(((((((,.....,,,.{(((..(((((((((((((({.,(((...((((((((.((((((...(((((.{{((((({{...,|||}.|{{{{,{((((,,,.{,||||(((((({,((((((((((.....))))))))))|((((((,{{({,(((({.((((((..((((....(.((((.((((,.(((((((.(((((((((((((((.((((((.(..((({...})))..).))))))((((((.,,.........,,....,.)))))).............((((((,{.(((((.{{...(((((((((.((..(((((((..(((((...{((,......,.,....{,,|},.,,||,|{{|..,{,,..|||||},|,{{..........,,}||||||,,,,.))))}}......)))...)))))))))))).)).))))))))).,..}}.))))).},...(((((.(((((((......((((({{..(((((({((((((........((.((..{((({....})))})).))....))))))......)))})))......))))))})))))))...)))))......(((((((....)))))))))))))....)))))))...))))))))))))))).,)))).)))))))))..)))))),{(((((....,...........,...)))))}.....((((((....}))))).{{{{{{{{{|,,,,,,)}}}.,|||},,..((((({....})))))|||,({((.(((.(..((.((,,.(((((((.(({...}))...)))))))..},.)).))..)))).))}}..,,.....,.........,,,.((((((((......))))))))...||||||,,..,})))))))}}}})))),.)))})))))}.{((({{|.,.|{{{|,,||||||,,,,........,...})))}}))))).))))))),|.(((.(((((........(((((((((((((((({,..,,,,,,...{((,((,,({{(((({{{{.,,,,,........,}}}}}}}}..((((.....,.})))........,,,,,.,,{{{{{{{{{..,,,((((({{{{||||||{,,,..((((,,(((((.,,..{{((((((..........,,{,....,},,..(((((((..((((.....))))......))))))).)))))),))..)))))))))).(((((.,..((((..(((((((((((((((((......,.)))))).....)).)))),{((.(((....))).))}.,,,......................,,.(((((((((.(({.....)))))))))))).....{((({(((((.........{{,...((((((.(((((((({........((((((........))))))((((.........))))..(((((((....)))))))...(((((((((.....{(((((((.{({{...(((((((((((,...,)))))}.,,..}}))))......}))}.}))))))}..,{{{,,,..,,,,......,,))))..})))))))){(((((((((.{.....(((((((.....(((((({,((((((....................)))))))))))))................,{{((.......(((((.,..(((((((....(((...)))....))))))).,.)))))......}}))}.)))))))),)))))))))),......,(((((((((((.....)).))))))))).,.,.))))))))).)))))),,,....,....))))))))}.}})))..))))...)))))..,...{{{.,{{{|||||||||,({{{.(((((({.........)))))))}))}.,,...((((......)))).,.}||||||}|||}},..}}},}}}}}))))))...)}.,,,.,}}))))))))))))))))))))))).........))))).))).}),,,))))).))))))))))))))....,{{,.,{,{,,,,...,||||,,||,.|||||.(({((({{{(({{{{{{{|..,..||||},,...))}}},,,,|||||}||..||{...))),,))|||||,{{{{{{{.{{{.||,.})).)}}}.))}.}}))}....,)))))))))))}..))))))..)))),}},,.{({{{(....{|,..|{..||||{||,|||||,|{{(((({||{{||{,,..,},|.}}})))))))).}}}}}}}},,,}}..)).},....})))))))))))),,},,,,,.,)))))))}}}.....,.....),))))))),.}))))))))....{((((............))))}.{{,(((((.((((((....))))})}.)))))}})))))))))....))))))))},,...{(({((((......))))}))}...,}).))))))}(((((((((((.....((((((((((,......{((((((.{,...,,..))))))))))))).)))).....)))))}...})))))...{(((({...}))))},.((((((((...{{,,....,},,)))))))).,,,,......

Transcripts

ID Sequence Length GC content
GCCGCGCUGCGCCCGCUCUCCCGGCCCCGGCUGCCCCGCUGAGGGCUCC… 6057 nt 0.4291
Showing 11 to 11 of 11 entries
Summary

This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]

Forensic Context

A study in humans undergoing cardiac surgery with cardiopulmonary bypass identified the mRNA CACNB2 as a predicted target of the upregulated miRNA miR-339-5p, showing a strong anticorrelation (Pearson r = -0.81) in expression within postischemic left ventricular samples [Saddic et al. DOI:10.1152/physiolgenomics.00049.2015]. This mRNA functions in ion transport and its integration into an anticorrelated miRNA-mRNA pair analysis demonstrates an association with pathways related to cardiovascular disease, cell death, and metabolism following acute myocardial ischemia. A study in mice demonstrated that endothelial cell-specific exposure to α-particles in the liver caused a down-regulation of the CACNB2 [Roudkenar et al. DOI:10.1269/jrr.07078].