Basic Information

Symbol
CACNB4
RNA class
mRNA
Alias
Calcium Voltage-Gated Channel Auxiliary Subunit Beta 4 EJM4 Voltage-Dependent L-Type Calcium Channel Subunit Beta-4 Calcium Channel Voltage-Dependent Subunit Beta 4 CACNLB4 CAB4 Dihydropyridine-Sensitive L-Type, Calcium Channel Beta-4 Subunit Calcium Channel, Voltage-Dependent, Beta 4 Subunit EIG9 EJM6 EA5 EJM
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000726.5
Sequence length
7944.0 nt
GC content
0.3463

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1845.90 kcal/mol
Thermodynamic ensemble
Free energy: -2014.52 kcal/mol
Frequency: 0.0000
Diversity: 1958.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((..(((.(((((((((.(((..((..(((((..((............))..)))))..))..))))))))............))))))).))))).((((((((..(((((.(((((.(((((((.......(.(((.....))))))))))).))))).(((((((((((((.(((((((...(((........)))))).)))).)))..)))))........))))))))))((((.(((.((..((((.((((((((((.(((((((((((((((((((((.....(((((..(((((((((((((.(.....).)))))).......)))))).)...)))))((...(((((.((...)).)))))....)).((((((..(....(((((((.(((((...............((((((((((((((...((((((((((((((....((((((((((......)))))....))))).......(((((...(....)..)))))(((((......(((((((.((((((((.((......))..)))))))))))))))....))))).....(((((.((((...((((..(((((((((((((...((((.((.....((.(((.....((((((.(((((((.........)))).))).)))))).))).))...)).)))).)))))((.((((((.....((((....(((.((....)).))).((((..((((((......((((.....))))......)))))).))))..))))...)))))).))......((((((((((..(.((..(((.....)))..)))))))))))))......((((....))))((..(((...........)))..)).(((((...............)))))(((((.(((.....))))))))))))))))..)))))))).)))))...))).)))))..............))))))...)))))))))))))).))))))))))))...)..)))))).....(((.((((((..(((.(((((((..((((((((((((((((.((((((((((..(((....)))..((((((..((((..(((((((((((((((...((((.((((.....))))..))))(((((.(((((...((((...((((((......)))))).((......))(((((.(((((....((((((((..............))))))))....)....))))......)))))..))))..))))))).))).))))))))).......((((((((((((((((.(((((..........((((.(((((..((((..((((((.(((....))).))((((((...)))))).......((((...((((((..((......))..)))))).(.((((.((...)).)))).)....))))...((((((((.......((((........))))..(((((((......(((((....((((......(((((((((((...(((((((.........(((((((((((..((((......((((((((((((..(((..((((((.((((...)))))).))))............(((((((...(((((((((((....)))))))).)))(((....))).......))))))).(((((((..................)))))))..)))))))))))))))..((((....(((..(((((.((((((.((((...........((.(((((......))))).))......(((........)))..(((((((..........))))))))))).........(((((((......)))))))...........(((((....)))))((((((((...((((((((....)))).))))))))))))..)))))))))))..)))))))..........(((((((....(((((((((((.......................(((((((((....(((........)))))))))))).(((((((.(((((.....(((((((.......)))))))..(((((........)))))......(((((((((....((((((.....((((..........((((((..((((((((((.(((.....((((......)))).....)))....)))))))..............)))..)))))).(((((((.........(((((((((...((((((....((..(((((((((....).))))))))...)).....))))))))))))).....)).........)))))))((.(((((.......((((((((...(((...))).((((.((((((((...........(((((.(((..............))).)))))(((.(((((((....(((((....))))).....))))))))))....((((.(((((((..........)))))...)).)))).......)))))))).))))......((((((........))))))....(((((.....)))))......))))))))...))))).))))))....))))))))))))))).....(((((((((((((........)))))))))).)))....(((....)))((((((((....(((((.((..(((((...)))))..))..))))).))))))))................))))).)))))))...........(((..(((((((....))))))))))........((((.......(((((((.......(((((((......((.((((.((((((....(((((........))))).................(((((.......((....((((((((......((..((.(((((......((((......((((((((......))))))))......)))).........((((((.((....))...))))))..))))).))..))......))))))))....)).......)))))...))))))..))))))...))))))))))))))......))))...((((..((((..(((((.((((....)))).))))).)))).)))))))))))))))....))))))).)))))).)))))))))..........((((((((...........(((((.....))))).)))))))).)))))))...)))))).....)))))......))))..........(((.((((...((((((.(((((((......))))))))))...)))....)))))))...))))).....)))))))....((((....))))........(((((((.((((((.(.(((((((.(((...((((.(((((.((((.....(((((((((((((..((((((((((...........((((((..............((.(((((((..(((((.....)))))....)))))))))......))))))..))))))))))..))))))))..))))))))).......(((((((((((.....((((((((...(((((((((((((....(((((..(((((((((((........))).)))..)))))...))))).((((.((((((...))))))))))....((((((....)))))).......((((((((.((((....(((...........)))..)))).)))))))).........................)))))).)))))))))))).))).....)))))))))))..(((((.....)))))........................))))).))))))).)))))))..).)))))))))))))..))))))))))).)..))))...))))))))).....(((((((............................)))))))...........))))).)))...)))))))....))))))...........))))))..))))...))))))....)).)))))))).))))))))))..(((((....(((((((((((......((((((..((.(((((.(((......)))))))).))..(((((..((((((((((((....)))))(((((((((..((............((((((((((((((((..(((((......((((((((.((((..((((..(((.((((((((((.........((((((((..((((((((((((((((((((((.(((((((.(((((((((((((((.(((((..........)))))))))))((((.(((.......((((((....(((.........))).(((((((((((((....)))))...)).)))))).))))))...)))))))..(((.....((((((...))))))...)))(((((((..........((((((((((.......))))))).)))...)))))))))))))))).................(((((.(((..(((((.(((((.......))))))))))))).)))))..(((((((..(((.((((((....)))))).))).....))))))).......((((..........)))).....)))))))...))).)))))))....))))))....))))))..))))))))....(((((((....)))))))..(((((((......)))))))......((((........)))).)))))))))).))))))).((.(((((((((.((((((((...((.....))...)))))))).(((((....(((.......)))...))))).))))))))).)).......(.(((((((........))))))).)........((((((..((((...(((((.......(((.....)))....))))).))))))))))))))))))))))....))))).))).)))))))))))))))....))))))))).((((..(((((((.((.........)))))))))..))))(((((((.(((.((.(....((((((.(((((..((((((...(((((((...)))))))..))))))......((((((...(((((((((.......))))))))).)))))).((((.(((((((......((((((.....(((((....(((((.((((..((...((((((((..(((((......))))).(((..((((...((((.((....)))))).......))))..)))..))))))))))..)))).)))))...))))).........((((((.(((((((((((((((((((((((.....)))))))((((((((((((((((...........(((.(.(((((((..((((((....))))))..((((((((((((.....))))..........(((((.((((...))))...)))))(((((.((((.(((.....))).))))..)))))....))))))))....((((((..(((((((....((((.((.((((...))))..)).))))......)))))))..))))))..)).)))))).)))))))))))).))))))).....(((((............)))))(((....))).((((.((((...((((.....(((.((((((....((((((((....)))))))))))))).)))..)))).)))).)))).(((((.......))))).(((((((((((..((((((....((((((((((((........))))))..................(((...((((((((((.(((..((((...))))..)))..))))....((((((((((((..(((......))))))))))).))))....))))))...))))).))))....))))))..........((((((((((((......)))))).......(((...................)))((((((((..(((.(((..((((.(((((((((............(.(((((......))))).))))))))))))))..))).)))..)).))))))..........(((.(((.....)))..)))......)))))).......)))))))))))....))))))((((((((((......)))))..))))))))))))))).)))))))))))).....)))))))))))..))))).)))))).......).)).))).)))))))(((((.((......)).)))))....)))))))..)))))..))))))))))))...)))))))))).))))))..))))))).)))))))).)))).(((((((((.............)))))))))..))))))))((((((((.((((..........((((((..........))))))..)))))))).)))).......((((....))))(((((....(((((((...(.(((((........((((..(....)..))))))))).)))))))).....)))))(((((((............((((((((((((((((((((((...((((((.(((((((....(((((((((((((((..(((((.......)))))...)))).))))))...)))))(((((...)))))..............))))))).)))))).........(((((..(((((((((((....((((((((((.......)))))))))).........((((((((((((.((((((((...)))))))).)((((((....)))))).)))))))))))......................((((((...((......))))))))...(((((((((((((.......((((....((..((((((..............((((((((..(......)..))))))))...(((.((((.(((((((((.((((((((((...(((((..(((.((((.((((....(((((.(((((((((((((...)))))).(((((.((..((.(.((((.(((((......))))).)))))))..)).)))))........((((((.((((((((.................))).)))))))))))))))))).)).)))........((((((........))))))......)))))))).))).))))).)))))).))))...........((((....))))................)))))))))....))))))).))))))..))..)))).......))))))).))))))...((((.(((....((((.(((((.....)))))))))...)))))))................))))))))))).)))))..))).))))))))))))))..))))).................((((.((((...)))))))).)))))))))))))))......(((.((((....)))).)))))))).)))..))))))).))))..)).))).)))).............)))))))).(((((((.(((......))).)))))))..(((((.......))))).(((....)))..(((((((((.....)))))))))......)))))..................((((((((.(((((...))))).))))))))........
Thermodynamic Ensemble Prediction
,{,,.((((({.{((.(((((((((.(((..((..(((((..((............))..)))))..))..))))))))............)))))))}))))).((((((((..(((((.(((((.(((((((.......,.(({.....))},))))))).))))).(((((((((((((.(((((((...(((.,....}.)))))).)))).}))..)))))........))))))))))((((.{{{.{{..((((.((((((((((.(((((((((((((((((((({.....(((({..{((((((((((((.{.....).)))))),..,...}})))).|...|}}}},{{{.(((((.({...}}.))))),||.,,.((((((,,(....(((((((.(((((...............((((((((((((((...(((((((((((((({((((((((((({,..,,,.|}}}}{{{|||{|,.....}}|||||.......{|{,||||.(((((.,....(((((((.((((((((.((......))..)))))))))))))))...,)))))......,||{,}{(,(({...))).}}..,}|(((((...((((.((...{.((.(((.....((((((.(((((((,........))))},)).)))))).))).)).,.)).)))).)))))|,{((((.({....(((((...)))))...}})))))}....))))))))}|....,((({.....}}}).,|{,{|||}|||{{||,.....{,,{({..,.|,,..,..{(((((((((..{|((..{,,.....,,,.,)}})))))))))}......,}}.,.,}))(((((.(((((,(((((({{.{{{....,,{,......}}.......})})))))))){(((,...,)))).))))).))))){{{{{{......,)))))}}))})))))....{{,...,}}.))))))...)))))))))))))).)))))))))))),,,}..}))))).....{{{.{(((((..(({.(((((((..((((((((((((((((.(((((((((({.(((....))).|{{{(({..((((..((((((((((((((({,,,({(({,{{,,{({(({...,||{{{.,,...,||),}}},,.))))}|{(((,((.{{((({{({,((({{{.{{{...,,,,}}}..||||||||....|||...,}},||||,|||{,.||....}}}|||,}}.))}})}}}}.}},,,)}})))))).}))))))))...,{({((((((((((((((((.(((({..........(((,,(((((..((((..,(((((.({(,.,.||}.}}((((((...})))))...,{..((((((.((((((..((,.....))..))))))}}}|||{.({...}}.)))}.,....,,})},,|(((((((.......((((........))))..(((((((......(((((..,,,(((....,}|(((((((,,({{{(((,{,,....}}}.}|||((((((((..((((.,....((((((((((((..(((...,{{({.((((,,.||||||.||,.........,}},{((((((...(((((((((((....))))))))},))(((....)))....,,.))))))).{((((((...............,,.))))))}..))))))))))))))).,{({{...|||{,.{{{{{.,,,,{{,(((,..,|||||...{{.{{(({......))))}.}},}}}})))}}}}},.........{(((({{...{{{{..,|,{{{{{...{{{{,..,,{{{(({({,.{{((({|.,||,....}....,||||},},)))},((((((((...((((((((....))))})})))))))))).,{,|,.,}))}}.,|||||||{{({,.....(((((((....(((((((((((.......,{{..,,,{,......((((((((,...{(((........)))))))))))).{((((((.(((((.....(((((((.......)))))))..(((((,.......}}}}}}}}}}}(((((((((....((((((.....{{{.......,...((((((..({{{((({,,.{(({{{,,,,,,..,{{.||,,...,||||....)))))}),..}}}}})})},.}}}..)))))).(((({{(.,,,.,{{({,(((((((...((((((....{{..(((((((((....),})))))))...}).....))))))))))))).,,......,......))))}})((.(((((.......((((((((.,.{((...)))|((((.((((((((....,,(({{,(((((.(((..............))).))))){((.(((((((....(((((....))))).....)))))))))}....{(({|({(((((..........)))))...)).)))}..,,,,.)))))))).)))).,....((((((........))))))....{((((.....}))))......)))))))),..))))).))}}}},,..))))))))))))))).....{((((((((((((........)))))))))),|||....(((,,.,|||(({{{{((,...,{|||,||.|||{||,,,}})))),},..}}}},.}}})))))..........,,....))))).))))))}...........,,{..(((((((....)))))))}}|.....,,.{{{{.......((((((,......{((((((((((({,{(,({{(.((((,,....(((((........))))).....}}))....,.}}}}}|}}}},((((({...,(((((({.,{(({{,,,({,({,,,....,,||||||....((((((((......))))))))......,|||,{..,,...,{{{{,.......}},..,...,,..,,.,,.,,,}}}..,|,,|}}}}}}},...})}}},...,,....,,,}))),..,))))))..})))))))))))))......}}}}.|,|{{{..{{{{..{{{{{.((((....)))).)))))}))),.})),)))))))))))....))))))).,},,,),)}}}}}}))}))}....,.((((((((...........(((((.....))))).)))))))).))))))).,,))),))}}}.,))),)}}}}},,,,,.....,}}}}||,.{{{({,,{{((((,(((((((......)))))))}}}...}))},}.,)))})).,.))))).....)))))))....((({....})))......,,{((((({.((((((.{.((((((({(({...,(((.(((({.,,,({,,(.(((((((((((((..((((({((((....,..,,,,(({{{({{{,....,}}},.}|}}}|.||,......((((..{{{,|.....}})))..))))...,,}}}}..))))})))))..)))))))),.})))),)))}......(((((((((((.....((((((((...(((((((((((({,,,.(((((..((((((({(((........))).))}..)))))...))))).{{{(.((((({...,))))))))}....((((((....)))))).......((((((((.((((....(((.,......)}.)))..)))).))))))))............||||...,,,...))))))}})))))))))))},)).....)))))))))))..,{{{{...,,|||,,..,,}}}...............,,))))).)))))))})))}}))..,.))))))}))))))}}))))))}}))).}..))))...))))))))).....((((((({{.......................,,.)))))))........},.})))).)))...)))))))....))))))..}},,}....))))))..))))...})}))},.,})),)))))))).))))))))))..(((((....(((((((((((,.....((((((..({.((((,{(((......}))))))).}}.,(((((..(((((((((({{...,}}}}|(((((((({.,{{............((((((((((((((((..(((({......((((((((,((({..{(((..(((.((((((((((.........{(((((((..((((((((((((((((((({((.{{((((({(((({((((((({{,,({({{,,,,,,,,,,||||||||,,,..,,.|}}}}...,,((({{{.,,{({{.,,||,..,|,,.(((((({{(((((....)))))...}}.)))))).}}}))),|,|||}||||,{|......{{{{{|...}}))||,,.,,,||||{......,,,..|({((((((((.......)))))))}.))...,|||,,.}}||||}|}....,,.|||},.....{((({.((|.,(((((.(((((.......))))))))))))).})))}..(((((((..(((.{(((((....)))))}.))).....)))))))..,},,}||{|,,..,,,,||||||.,,,.))))))),..})),})))))))}}}))},,,....})))))..)))))))}....(((((((....)))))))..{((((((......))))))}......,{{{.,..,..,))},.)))))))))).)))}))}.((.(((((((((.((((((((...((.....))...)))))))).(((((....(((......,))}...))))).))))))))).)).......(.(((((((........))))))).)...,,,..{{{{{|..{{{{,((((.,,.,...,,|||,,...,,,...,}}})),)))}}}}}}))))}))))))))....))))).))).)))))))))))))..|||,}))))))}|{((((..((((({({((.........)))))))))..))))}|{{{{{.{{{.||,,,,,.((((((.(((((..((((((...(((((({...}))))))..))))))......((((((...(((((((((.......))))))))).)))))).((((.((((((({{....((((((...,.{{{((.,..(((((.((((..{(,..((((((((..((((,..,,,.,}})),|{{..((((...(((,{((....)))))).......))))..))}..))))))))}}..)))).)))))...)))},.........((((((.((((((((({(((((((((((((.....)))))))((((((((((((((((...........(((,{,{{{(({,,.{{((((,..,)))))}..{{{,,,{|||{{,.,,.,}|}..........|||||,|{||...)))},,,|}|||(((((.((((.(((.....))).))))..)))))....}})))))},...((((((..(((((((....((((.((.{,{,....,,}..)).))))......)))))))..))))))..,,.}}}}}}.}},))))))))).)))))))..{{,(({{{........,,},))}}}{{{....}}}.((((.((((...{,{,..,..{{{.(((((({{..,(((({,.....}))))))))))))).}}}..}}}..)))).)))}.(((((.......))))).(((((((((((..(((,(((.{{((({(,(((({({{{{{{{.,,.,,,....{{{{{{{.......,,,..{((((,{(,.....({((((({{..|||,..,,.,({|,..,,{(((((((((((..{((......))})))))))).)))}....}}|||}...|||,}.,)))....,,,}}}.............,,,((((((......)))))}.......|||..,,.,............,}}}||||,|||}}|||},,,..,||,}||||,,|||}}},..,...,.{,(((((......))))).}}}}}||||||,,|{{,,,.))).}))})),}}}.....,..})))}))}...,}}),},}.))}}}.}}).)))........)))))))))))....))))))((((((((((......))))}.,)))))}))))))))).))))))))))))....})))))))))))..))))).))))))..,,,,.,.,,,))).))}}}}}(((((.{{......}}.))))),..})))))))..)))))}.))))))))))))}..}))))))))).))))))..))))))).)}}))))}.})}}.(((((((((.............)))))))))..}))))))}((({((((.((((,,,.......({(((({,.....,,})}}}}}.,)))})))).}}}}.......((((....))))(((((....(((((((...{.((((({.......((((..{....}..))))))))).)))))))).....)))))(((((({............((((((((((((((((((({((,..((((((.(((((((....(((((((((((((((..(((((.......)))))...)))).))))))...)))))(((((...})))}............,.))))))).)))))).,,.....,{(({{,,(((((((((({....((((((((((.......}))))))))).......,.{(((((((((((.((((((({...}))))))).)((({{(....}})}}}.))))))))))),..................,,.((((((...((......)})))))).,,{((((((((((((.,.....{{{{|,,.{{..{{{(({,,,{{{{{......{((((((({,...}))))))))..|(({,...,,.}}}|}{{{{{{{{|||,,,,{{{{{{{{{{{{{.,{|,.,|{,.,|{{||||||{{{{{({{{(|((((((...)))))),|{||{.,,.,((.{.{(((.(((({......))))).))))}}},,}|||||||,,,,....((((((.((((((((.................))).))))))))))),,)))))})).))).....{{{(,,.(({{{{{,,{||||,,...})})))))))))),))))||}|}}|})))})))}}},.......((((.,..}}})...,||,.......,|}}}}}}))|...,|},}},,.,}}}}),,))}))})).,,},}}))))))),,))))}...{(((.{{{,,,.{(((.(((((.....))))))))}...}))}))),}}},}},........})))))))))}.,},}}.,))).))))))))))))))..))))).....,......,.....|||,|{{{{{{{....)))))))))))))))))))......(((.((({....)))).))}))))).)))..))))))).))))..}}.}}}.)))).............)))))))}.(((((((.,((......))}.))))))).,((((({.,{,,,|||||,(((....)))..{((((((((.....)))))))))......})))),....,,..}))))}}..{(((((((.(((((...))))).)))))))}...,,...

Transcripts

ID Sequence Length GC content
CACAGGACAGCUGAGUUUUUCUGUAAGAUGGGAAGUGAAGAGUGCAGUG… 8091 nt 0.3461
Showing 11 to 11 of 11 entries
Summary

This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]

Forensic Context

A study in mice demonstrated that the CACNB4 is an RNA-binding target of hnRNP H1 in the striatum, containing G-rich motifs and being part of the enriched "presynaptic depolarization and calcium channel opening" pathway [Ruan et al. DOI:10.1016/J.Pnpbp.2025.111598]. In a separate investigation, chronic methamphetamine administration in mice significantly downregulated the CACNB4 in oligodendrocytes within cortical regions, where it is associated with the MAPK signaling pathway [Oladapo et al. DOI:10.3390/Ijms26020649].