| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAACUGUCUGGGACAGACGCUGCCCGGAUCCCUGCGGCUGCCUGCACU… | 874 nt | 0.6682 |
This gene encodes a novel calcium binding protein expressed in the epidermis and related to the calmodulin family of calcium binding proteins. Functional studies with recombinant protein demonstrate it does bind calcium and undergoes a conformational change when it does so. Abundant expression is detected only in reconstructed epidermis and is restricted to differentiating keratinocytes. In addition, it can associate with transglutaminase 3, shown to be a key enzyme in the terminal differentiation of keratinocytes. [provided by RefSeq, Jul 2008]
A study in humans examined candidate mRNA markers for skin identification, where the CALML5 was initially ascertained from the GNF SymAtlas database as a skin identification candidate [Visser et al. DOI:10.1007/s00414-010-0545-2]; however, subsequent experimental testing revealed that the CALML5 showed non-specific amplification among the tested samples [Visser et al. DOI:10.1007/s00414-010-0545-2].