| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCAGACAUGGGGACCAUGAAGACCCAAAGGGAUGGCCACUCCCUGGG… | 591 nt | 0.5415 |
This gene encodes a member of an antimicrobial peptide family, characterized by a highly conserved N-terminal signal peptide containing a cathelin domain and a structurally variable cationic antimicrobial peptide, which is produced by extracellular proteolysis from the C-terminus. The protein plays an important role in innate immunity defense against viruses. In addition to its antibacterial, antifungal, and antiviral activities, the encoded protein functions in cell chemotaxis, immune mediator induction, and inflammatory response regulation. [provided by RefSeq, Sep 2021]
A study in mice demonstrated that the CAMP (Camp) was the most significantly upregulated gene, showing a 16.4-fold increase in lung tissue following hypothermic death [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789]. This RNA marker was validated as a candidate forensic biomarker for hypothermia via quantitative PCR, and immunohistochemistry confirmed increased protein expression in the cytoplasm of alveolar cells, indicating its role in the acute pulmonary host defense response to hypothermia.