Basic Information

Symbol
CAMP
RNA class
mRNA
Alias
Cathelicidin Antimicrobial Peptide FALL39 CAP18 FALL-39 LL37 18 KDa Cationic Antimicrobial Protein CAP-18 Epididymis Secretory Sperm Binding Protein HCAP-18 CRAMP HSD26
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_004345.5
Sequence length
591.0 nt
GC content
0.5415

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-209.10 kcal/mol
Thermodynamic ensemble
Free energy: -221.02 kcal/mol
Frequency: 0.0000
Diversity: 175.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((...(((((((.((((.....(((...)))))))))....(((((((((((((....(((((.(((.((((..(((((((((((((((...)).)))))....)))))))).))))....((((.((((.(.((.((((((....)))))).)))))))..)))).))))))))....)))))))(((((((.(((((.(((((..((......)).)))))..........((....))((((((...))))))(((.((.(.((.(((.(((((.....((((.((..(((((((.....(((..(((....))).)))..))))))).)).)))).)))))))).)).)))))).)))))))))))).((((((.(((.....))).).))))).............((((....))))(((((((...))))))).....(.((((((.(((((((((((.......((.....)).......)))))))))))..)))))).).)))))).((((((((.(((.((.(((.......))).)).)))...)))))))).........)))))...))......
Thermodynamic Ensemble Prediction
.((((,.({(,((((((,{.....(((..,|||{.(,,,,||}|}},})},|)))))).||{|||||{||((((,.(((((((((((((((...)),}))))....)))))))).))))....|||{,{({{.{,{{,{(((({....}))))).,)))))}}})))),}|.}||}...{{{{...(((.(((((.(((((.(((((..{(,,...,)).)))))..........{(....}}((((({...}))))){({{((.(.((.(((.(((((.....((((.((..(((((((....,({(..{{{....,)}.))}..))))))).)).)))).)))))))).)).)))))}.)))))))))))))((((((.(((.....))).).))))).....{{{{{{{{(({(..,,|||||||||||,..|}}}}||,....{.{(((((.(((((((((({....,,.{{.,...,,,|,||..})))))))))).}}})))),},}})))}}((((((((.(((.((.(((.......))).)).)))...)))))))).............,}}})}......

Transcripts

ID Sequence Length GC content
AGGCAGACAUGGGGACCAUGAAGACCCAAAGGGAUGGCCACUCCCUGGG… 591 nt 0.5415
Summary

This gene encodes a member of an antimicrobial peptide family, characterized by a highly conserved N-terminal signal peptide containing a cathelin domain and a structurally variable cationic antimicrobial peptide, which is produced by extracellular proteolysis from the C-terminus. The protein plays an important role in innate immunity defense against viruses. In addition to its antibacterial, antifungal, and antiviral activities, the encoded protein functions in cell chemotaxis, immune mediator induction, and inflammatory response regulation. [provided by RefSeq, Sep 2021]

Forensic Context

A study in mice demonstrated that the CAMP (Camp) was the most significantly upregulated gene, showing a 16.4-fold increase in lung tissue following hypothermic death [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789]. This RNA marker was validated as a candidate forensic biomarker for hypothermia via quantitative PCR, and immunohistochemistry confirmed increased protein expression in the cytoplasm of alveolar cells, indicating its role in the acute pulmonary host defense response to hypothermia.