| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACGACGAGUUUCAGAACGAUGGAGAGCUCCCGCGUGAGGCUGCUGCCC… | 800 nt | 0.4662 |
This gene encodes a preproprotein that is proteolytically processed to generate multiple biologically active peptides. These peptides play a role in appetite, energy balance, maintenance of body weight, reward and addiction, and the stress response. Expression of a similar gene transcript in rodents is upregulated following administration of cocaine and amphetamine. Mutations in this gene are associated with susceptibility to obesity in humans. [provided by RefSeq, Feb 2016]
A study in rats demonstrated that the CARTPT mRNA expression in the hypothalamus and frontal cortex showed no significant change in a fatal hypothermia group compared to controls [Umehara et al. DOI:10.1016/J.Legalmed.2011.01.005]. In mice selectively bred for methamphetamine consumption risk, the CARTPT was mentioned as a gene upregulated in a rat model of compulsive methamphetamine taking but was not experimentally studied in that investigation [Hitzemann et al. DOI:10.3390/brainsci9070155]. A study in rats and mice demonstrated that the CARTPT mRNA is increased in the hippocampus following experimental traumatic brain injury [Dash et al. DOI:10.23/B:NERE.0000023614.30084.eb].