Basic Information

Symbol
CARTPT
RNA class
mRNA
Alias
CART Prepropeptide CART Cocaine- And Amphetamine-Regulated Transcript Protein Cocaine And Amphetamine Regulated Transcript
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Drug abuse diagnoses Mechanical injury analysis

MANE select

Transcript ID
NM_004291.4
Sequence length
800.0 nt
GC content
0.4662

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-221.70 kcal/mol
Thermodynamic ensemble
Free energy: -239.99 kcal/mol
Frequency: 0.0000
Diversity: 253.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((.((((((.......((.((((((..((((..(((....)))((((((((((((.((((.((................)).))))....)))))))))))))))).))))))...))(((.......(((((((((((((((((((((.(.((.(((........)))))).)))....(((((((((((.((((((......)))))).((((((..(((((.(((.((...(((.((((...((((....((((((((((((((.((((((.((((((((.(((((((((((..((((.((((...((((((.........((((((((((((.((...(((((.....)))).)....)).))))).))......))))))))))))))).)))).....(((((((((((((((((.((..(((.....))))).)))..........(((((((...))))))))))))))..))))))).))))))))))))))))................(((((.((......)))))))....))).)).))))..))))))).))))))).((((((((....))))))))((((...))))...)))).)))).)))...)).))).)))))....)))))).........)))))))).))).)))))))))......(((((......)))))....))))))))).........)))........((((.....)))).......)))))).)))...((..((((........))))..)).......
Thermodynamic Ensemble Prediction
.((((.(((((((((,.{({,((.((((((..((((..(((....)))((((((((((((.((((.((.,,....,........)).))))....)))))))))))))))).)))))){,,|...{{{{{{{((((((.((((((.,(((((..{....},,))))).....(((((..{|.({(.(((......}))}))|,,..))))).))))))...)))}}},,.,{,.,{,|.,{{.((((((...,{.....,.(((.((((((.{((((((.{...(((.((((((((((((,,((((((((,.{{.{,..,.}.,,.)))))......))))}}...}))))))))))).).))))))}.....))))))))}..,.}})))))).)).,.,},,.....,{(((((((((((({{{.{,..(((.....))))|.})}.....,,...{((((({...,}})}}})))))))..)))))))})))),,,,,}|}}}}|,,....,,,,...,.,((((,,({......})))))}....,{{{{(({.,...,)))))),}}}}},}.|{{{{{{{....))))))))}}})))))..)))))))))...(((((.,....},))))},.{{{{(({{,,.....{((({.{(((((((({.|,{{{{{{{.{{,...|||,.}}}.}))),,.{|{{|.,,||||{{,......,||........||{{....,))))}}...,}})}.}))))))))}}..})))},,}}}}})),}...........

Transcripts

ID Sequence Length GC content
AACGACGAGUUUCAGAACGAUGGAGAGCUCCCGCGUGAGGCUGCUGCCC… 800 nt 0.4662
Summary

This gene encodes a preproprotein that is proteolytically processed to generate multiple biologically active peptides. These peptides play a role in appetite, energy balance, maintenance of body weight, reward and addiction, and the stress response. Expression of a similar gene transcript in rodents is upregulated following administration of cocaine and amphetamine. Mutations in this gene are associated with susceptibility to obesity in humans. [provided by RefSeq, Feb 2016]

Forensic Context

A study in rats demonstrated that the CARTPT mRNA expression in the hypothalamus and frontal cortex showed no significant change in a fatal hypothermia group compared to controls [Umehara et al. DOI:10.1016/J.Legalmed.2011.01.005]. In mice selectively bred for methamphetamine consumption risk, the CARTPT was mentioned as a gene upregulated in a rat model of compulsive methamphetamine taking but was not experimentally studied in that investigation [Hitzemann et al. DOI:10.3390/brainsci9070155]. A study in rats and mice demonstrated that the CARTPT mRNA is increased in the hippocampus following experimental traumatic brain injury [Dash et al. DOI:10.23/B:NERE.0000023614.30084.eb].