| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCUGAGGCUCUUUCCAACGCUGUAAAAAAGGACAGAGGCUGUUCCCU… | 1296 nt | 0.4552 | |
| ACUCUGAGGCUCUUUCCAACGCUGUAAAAAAGGACAGAGGCUGUUCCCU… | 1395 nt | 0.4509 |
This gene encodes a protein that is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain and a large and small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This caspase is able to cleave and activate its own precursor protein, as well as caspase 1 precursor. When overexpressed, this gene induces cell apoptosis. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
A study in human cadavers demonstrated that mRNA in liver tissue remains stable for postmortem gene expression analysis up to 48 hours, and PCR array analysis of the apoptotic thanatotranscriptome showed the CASP4 was significantly up-regulated by 4.3047-fold in decaying tissues compared to a 6-hour control, indicating its role as a pro-apoptotic caspase activated during postmortem cellular processes [Javan et al. DOI:10.1007/S12024-015-9704-6].