Basic Information

Symbol
CASQ2
RNA class
mRNA
Alias
Calsequestrin 2 PDIB2 Calsequestrin 2 (Cardiac Muscle) Calsequestrin-2 Calsequestrin 2, Fast-Twitch, Cardiac Muscle Calsequestrin, Cardiac Muscle Isoform
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001232.4
Sequence length
2593.0 nt
GC content
0.4354

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-772.00 kcal/mol
Thermodynamic ensemble
Free energy: -824.70 kcal/mol
Frequency: 0.0000
Diversity: 576.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.(((((((.(((((((((.(((((((...)))))))((((......)))).(((.((((((.....(((.....))))))))).)))((((......))))....((((....))))....(((.((((((((((((((((((((((.....(((....)))))))))))).....((((......))))..((((((((....(((((((((((.....)))))))))))...........)))))))).....(.((((((((..........)))))))).)(((....)))(((((((((.((......)).)))))))))........((((((..((((((((((((.(((((.(.(((........((((....))))...........(((((.((((.((((....((((.(.(.(((((((((...))))))))).).).))))))).....).)))))))))..(((((.....((((..((((((((((((..(((((...((((.(((((((((((....((((.((((((((((.(.(((((((.(((((((((((.((((((.(((....))).))..........))).).)))).))))))).))))))).).......((.((((((.....)))))).)).))))))))))))))((((((((((((((.....................)))))))))))))).((((........))))...........((((((((.((((((.....)))))).))))))))))))))))))).))))....)))))..)))))...((((((....(((((.((.....)))))))((.((((((.((((.(((........))))))).))))))...))....((((((...(((((((....(((((.(...(((((..........((((((((((((((((..(((.((((......((((((((((((((........))...)))).))))))))..((((((..(.((((...)))).)..))))))......((((((((((((((((.(...(((((((.((((((((((((((........).))))......))))).(((....)))....)))).)))..)))).).)))))))))))......)))))((((((((...))))))))..((((((((.((.....))..)))).))))......((((((((((....((((........((((((.((((............(((...((.((.((....((.((..(.((.((.....((((.....))))....)).)).)..)).))....)).)).))...))).................(((.(((........))))))..............)))).)))))).((.(((((.((....)))))))))....)))))))))))))))))).)))..))))))).(((((((..(((((..((....(((((.((((......((....))........)))).))..)))......)))))))..)).))))).....)))))))))..(((((((((((((((.((((((.....))))))(((((.((((......))))..)))))((((.......))))((.(((((.((....)))))))))(((((....))))).........)))))))..)))....))))).)))))....).))))).)))))))....(((((.(((((((..(((((.....((((((.((((.((.((((((((........((.((((.((((((........))))))...)))).)).......)))(((((...))))))).))).)).)))).)))))).)))))..)))))))))))).....(((((((((((........))))))).))))(((((....))))).)))))))))))).(((((((.(((((.........)))))(((.(((...((((((......))))))..))))))((((((((.............))))))))(((((.(((.(((.(((((.........(((((..((((((((.(((((((..(((((((((((..........))))))))))..)..)))..(((.(((((...)))))..))).(((((((....)))))))........))))))))))))..))))).))))).))).))).))))).....(((((((......)))))))......))))))).)))))))....))))...)))))(((((((.((.....((.....))...)).)))))))(((((((....................)))))))..))).))))))..)))..)))))).))))))))).....)))))..)))))))).))).........(((((((((.......(((.(((((.((((...))))))))))))......)))))))))......))))))).))....))))))).))................(((.....))).....
Thermodynamic Ensemble Prediction
..((.(((((((.(((((((((,(((((((...)))))))((((......)))).{{(.((((((.....{{,...,.,,,)))))),}}}((({......))))....((((....))))....(({.((((((((,(({((((((((({....,(((....)))))))))))),..,.{,,{......|||,{{(((((((,....(((((((((((.....))))))))))){{{{.......,)))),,,...{(((((((((.{..(.((((,,(|{{,,|.((((((......(((((((((.({......}).))))))))).{.{{{..,,.....}||{{(((((,{(((((({((.(((.({{....{{((,,..}}}),.........})},}}},|||}|{(({{{{,{,({({..{{,,(((((...||||||,},.|{{{,,,,)))).....}))))),)))}},,||}}...}}})}},,,,,...(((((..(((((...{,,({(((((((((((....((((.((((((((((.(.(((((((.(((((((((((.((((.(,{{{.,,,}||,,...,,.},}))))).).)))).))))))).))))))).}....||.((.((((({.....)))))).)).))))))))))))))((((((((((((((...............,.,...)))))))))))))).((((........))))...........((((((((.((((((.....)))))).))))))))))))))))))),)),,....)))))..))))).{((.(((.(({.({(((((((((((.(((((((({.{...((((........)))).(((((((((.,.(((({.((....((,..,...(((((((....(((((.(...(((((..........((((((((((((((((..(((.((((......((((((((((((,,,,......}..}})))).)))))))}..((((((..(.((((...)))).)..))))))......{,((.(((((((((((.{,..(({({((.{(({,,,{({.{|,,.||,|,}}|,,||.}||,.,,||||||,..,,,}}..,.}}}},}},..}))),,.))))))))))).}}.,.,|||,((((((((...))))))))}}|(((({{{,|{.....}}..})))}})},......((((((((((....((((........((((((.((((..........{,{{{...((.((.((....}}.}).)).,|.{{.{{.{((((.......))))).}}.}}.,}||||.|.....{,,{..|,......................{{{.{{{.......,))))}}.......,......)))).)))))).((.(((((.((....)))))))))....)))))))))))))))))).}))..))))))).(((((((..(((({.{((,,..(((((.((((......((....))........)))).))..)))......)})))))..)).))))}.....))))))))),.((((({{((((((((.((((((,...,)))))),((((,((((......)))).,))))}((((.......)))){{.(((((.((....))))))),,(((((....))))).........}))))))..}}}....))))),}))))....).))))).)))))))....{((((.(((((((..(((((.....{(((((.((((.((.(((,,,,{,.......{{.{,{{.{(((((........}))))|,,,|,||{.{((({{...))}|||,}}},,))))),))).)).)))).)))))}.)))))..)))))))))))}.....,{{(((((((({,...,,,||}}}}),)))|((((.((((((((((((((...,.....,...))))))))))}.,)),}.)))))|},}||}}},|((((({,....}})}}|{{||||}.((((((((,,...........))))))))}))))))))....)))))))..)))))))))....,))).)))))),|.....,|(((((((((,(,....}).))))))))))))))))))),.}}}.})).))).))}}},|||||((((((....))))))},}}}}},}}}.)))))).,.)))))))).)}.})))))))))),,,,.....(((((((......)))))))...{{{({....}}))),,,,...}))))}}}),})}(((((((.((.,,..{{,....}},,.)).)))))))(((((((....................)))))))..|||,||{{{{{.{{{{..,...,.)))),,)))}}..,))))}..)))))))).})).........(((((((((..{{...{({.(((((.((((...)))))))))}))...,..)))))))))..,...}}}}))).))....))))))}.}}................{{{.....))}.....

Transcripts

ID Sequence Length GC content
AGAGCUGGCUGGACCCAAGGAGGUGAAGAGUCACUUUUCAGCCCCAGGA… 2593 nt 0.4354
Summary

The protein encoded by this gene specifies the cardiac muscle family member of the calsequestrin family. Calsequestrin is localized to the sarcoplasmic reticulum in cardiac and slow skeletal muscle cells. The protein is a calcium binding protein that stores calcium for muscle function. Mutations in this gene cause stress-induced polymorphic ventricular tachycardia, also referred to as catecholaminergic polymorphic ventricular tachycardia 2 (CPVT2), a disease characterized by bidirectional ventricular tachycardia that may lead to cardiac arrest. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the CASQ2 was listed among differentially expressed cardiac-related genes, with mutations reported in ion channelopathies or cardiomyopathies [Neubauer et al. DOI:10.1007/S00414-025-03414-4]. In a mouse model of myotonic dystrophy, immunoblotting revealed the protein level of the CASQ2 was unchanged in the hearts of double knockout mice exhibiting sudden cardiac death [Lee et al. DOI:10.1093/hmg/ddac108].