Basic Information

Symbol
CAT
RNA class
mRNA
Alias
Catalase EC 1.11.1.6 Epididymis Secretory Sperm Binding Protein
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden death from CNS diseases

MANE select

Transcript ID
NM_001752.4
Sequence length
2291.0 nt
GC content
0.4505

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-689.90 kcal/mol
Thermodynamic ensemble
Free energy: -739.67 kcal/mol
Frequency: 0.0000
Diversity: 521.52
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((....)))))).......((.(((((((((((((((((((.(((((.((((...))))((((....((((.....((((...))))(((.....((((((..((((.........(((.((((.((((..((...)).....))))...))))..))))))).))))))..))).((((..((((.......)))).))))....((((((...)))))).((((((.((((((((.((((((((....)))))..))))))))))).))))))..(((((......))))))))).))))......))))))))).))))))........((((....)))).....((((((((..........)))))))).((.....(((........)))....)).....((((((((((....).)))))))))(((((((((((...)))))..)))))).))))))))).))((((((((......(((((((((.((((((((((((...(((((............)))))......)))))))))....))).)))))))))......(((((........(((((((((....)))).)))))((((((...))))))(((((..(((.......))).)))))..(((.((((((((((((...((((((((((((((..((..(.(((((((..........(((((((((((((........((((...(((((((((((((((((((..(((......)))...))))))).......(((((.(((((((...(((......)))...)))))(((((.........((((((((((((...........)))))))))))).......)))))...(((((((.((......)))))))))....)).))))))).)).))))))))...))))....)))))...))))))))..........((((((.((..((((((((((..((((..((.((((.((((((((((((((......)))..)))))).......(((((..(((((((.........)))))))..)))))..))))).)))).)).))))..))))))............(((((((((((((((((((.((((........((((((.....(((((..........((((((....)))))).(((((....(((((.((.(.((((..(.((....)))..)))))..)).)))))..))))).(((((((((..(((..................(((...(((((((((..((.........))..)))))))))))).((((......))))..((((..((...))..)))).....(((((....)))))((((((((((..(((.....)))..))))))...))))..(((((.(...).)))))(((((....((((((.....((...(((((..........)))))...))....))).)))....))))).)))..))))))))).....((((((.......))))))(((((((..((((((((.((((..((........))..))))))...)))))).))))))))))))..))))))...))))..))))))).....)))))...)))))))....))))..)).))))))...))))))).).))..))))...))))))))))((.(((.((.(((((.(((((((((.......((((((((.((((........((((((.((((((.((((((((((((...))))))....))))))(((((...)))))...))))))..))))))..(((((((((..((((........))))...)))))))))(((((((.......))))))).)))).)).....))))))...............((((((((...))))))))..((((((....)))))).......((((((((((.......)))).))))))............(((((.(((((((((..(((....))).))))))))))))))....((((....))))..))))))))).))))).)).))).)).))))).))))))))))......)))))((((((..((((((((....((.(((......))).))...)))..))))).)))))).((((.....))))..)))))))).((((((....((((((............))))))......))))))...........
Thermodynamic Ensemble Prediction
..,(((((....)))))|(((({,{((,(((((((((((((((((((.((((({((.{(((((.{,((...,,{{..{{{..((((...}))){(,..{{{{({{{{..((((......,.))))..},}}}.)))))},}.))})},.)))}.,,(({,..,,|||||.{||||...,))))),|},|||,..,....{||,...}},...((((((...)))))),((((((.((((((((.({((((((....})))}.,})})))))))).)))))}.,...(({{.....{||..,,,..}))..)))}))))))))))}})))}....,{{.((((....)))).,,,.((((((((..........)))))))).((....,(({........)}).},.)}.....((((((((((....).)))))))))(((((({((((...))))}..)))))),))))))))).},(((,.....,.)}}(((((((((.{(((((((((((,..(((((............))))).,....)))))))))....))}.))))))))).,}},}{((({........(((((((((....))))}}))))((((((...))))))(((((,.(((.......))).)))))..(((.(((((((((((({{.(((((((((({(((,,{(.,{.(((((((.,,{{,....(((((((((((((........((((...(((((((((({,(((((({..((({....,)))...})))))).......|||||.|{(((((...(((......)))...)))))(({({..,.,,,,.((((((((((((...........)))))))))))}...,,..}}))}..,|||||||.,|,,.|{{|||.........,))}))}},}}.)}}}}))))))...)))}....)))))...))))))))|,,,,.....,||||(((((((((,{((.....}}}.{{{.{(((({.((({(((((({{(......}))..)))))}...}}}},,|||}.||{|||{.,{,,.{{{|||}}||{.,||},..{(((....||||,.(((((..(((((((.........))))))).))))).,||||,.((((....,{,,(((((,.,{{{(((({,....,,,,,{(((({....}))))}.(((((....(((((.((.(.((((..{.{{....)))..)))))..)).)))))..))))).,{,(((((({{,,......}}}}}}}}.....(((...(((((((((..,,.,,,....,))..)))))))))}}}.((((......))))..((((..((...})..)))).}...{||||,,..,)}},||||||||{,||(((,,...|}},.}}}}}}...}})),,(((((.{...).)))))(({{{....{{{|{,|{.,.|{,,.(((((.,......,.)))))...}}...}))),}}},...}}}}},|||||||,}}}}}}....||(((((.......)))))}{{{((((..((((((.(.((((..((........))..)))}}}.,.)))))).)))))))}))))..))))))}.,))),}})))),,),}))))))))))|||}|{((({....))))),}..||...)}))))))).}.)}..)))},..)))))))))){{.(((.((.(((((.(((((((((.......((((((,{|((({........((((((.((((((.{(((((((((((...))))))....)))))|(((((...))))),..))))))..))))))..(((((((((..,{(({.......))))...})))))))).,,{{,({{{,...))))),),}}}}.}}.,|,.)))))}.}||||,,,.,|}}.{{{(((({...}))))))}..{(((((....))))))...,,,.((((((((((.......)))).))))))............(((((((((((((((..(((....))).))))))))))))))..,,|{({....})),..))))))))).))))).)).))).}},))))).))))))))))......})))|((((((..((((((((.{{.{{.(((......))).},,,.)))..))))).)))))),.,,....}))))..{||{{|.,,.{{{|||,,..{((({{.,{..,,||...}}}}}}......)}})))..}},}..,,.

Transcripts

ID Sequence Length GC content
AACAGGCAGAUUUGCCUGCUGAGGGUGGAGACCCACGAGCCGAGGCCUC… 2291 nt 0.4505
Summary

This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]

Forensic Context

A study in mice demonstrated that dietary methylmercury exposure significantly altered the hippocampal proteome and transcriptome, with the CAT being upregulated at the protein level by both low and high doses and at the RNA level by the high dose, indicating its role in the antioxidant response to neurotoxic insult [Mellingen et al. DOI:10.1093/Mtomcs/Mfab022].