| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACAGGCAGAUUUGCCUGCUGAGGGUGGAGACCCACGAGCCGAGGCCUC… | 2291 nt | 0.4505 |
This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]
A study in mice demonstrated that dietary methylmercury exposure significantly altered the hippocampal proteome and transcriptome, with the CAT being upregulated at the protein level by both low and high doses and at the RNA level by the high dose, indicating its role in the antioxidant response to neurotoxic insult [Mellingen et al. DOI:10.1093/Mtomcs/Mfab022].