| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAUCCAGACGCUAAGGAAAAUCCCUAAGCAGAGAUUUUCUGUUGGAU… | 1355 nt | 0.4856 |
Predicted to enable voltage-gated calcium channel activity. Predicted to be involved in flagellated sperm motility; sodium ion transport; and sperm capacitation. Predicted to act upstream of or within establishment of localization in cell. Predicted to be located in plasma membrane. Predicted to be part of CatSper complex. Predicted to be active in acrosomal vesicle. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that spinal cord injury (SCI) causes significant, time-dependent reductions in sperm quality and quantity, along with degenerative histological changes in testes [Rezaian et al. DOI:10.1038/sc.2008.81].