| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACUCCCUUCUCGUCUCGAGGCCUGUGGCGUCUGGGUCCGUUGGGGCAG… | 780 nt | 0.6000 |
Predicted to be involved in flagellated sperm motility; male meiotic nuclear division; and sperm capacitation. Located in cytoplasm and sperm principal piece. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that spinal cord injury (SCI) causes a significant, time-dependent reduction in sperm quality and quantity, along with degenerative histological changes in the testes, and specifically induces a significant downregulation of the CATSPERZ at 4 and 6 weeks post-injury [Rezaian et al. DOI:10.1038/sc.2008.81].