| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCGCAGCGGACAGCGCCAAGUGAAGCCUCGCUUCCCCUCCGCGGCGAC… | 1491 nt | 0.5895 |
The product encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. Mutations in this gene cause a variety of myopathies, including nemaline myopathy, congenital myopathy with excess of thin myofilaments, congenital myopathy with cores, and congenital myopathy with fiber-type disproportion, diseases that lead to muscle fiber defects with manifestations such as hypotonia. [provided by RefSeq, Sep 2019] CIViC Summary for ACTA1 Gene
A study in rats demonstrated that heat exposure induces cardiac overload and damage, with mRNA expression of the ACTA1 (Acta1) gradually decreasing in both the atrium and ventricle for up to 2-4 hours post-exposure before returning to control levels by 8 hours [Nakagawa et al. DOI:10.1016/J.Legalmed.2011.12.001]. This reduction, alongside rapid increases in Nppa and Nppb and later increases in Myh6 and Myh7, indicates early myocardial dysfunction, with immunohistochemical detection of fibronectin-positive cardiomyocytes confirming subsequent structural damage.