Basic Information

Symbol
ACTA1
RNA class
mRNA
Alias
Actin Alpha 1, Skeletal Muscle NEM3 ACTA Actin, Alpha Skeletal Muscle Nemaline Myopathy Type 3 Alpha-Actin-1 EC 3.6.4.- CMYO2A CMYO2B CMYO2C CMYP2A CMYP2B CMYP2C CFTD1 CFTDM ASMA CFTD MPFD NEM1 NEM2 SHPM
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001100.4
Sequence length
1491.0 nt
GC content
0.5895

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-519.60 kcal/mol
Thermodynamic ensemble
Free energy: -546.05 kcal/mol
Frequency: 0.0000
Diversity: 439.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((((((((...(((((((((((((.(......).)))))...(((((.(((((....(((((.......))))).(((.((..............)).))).((.(.(((((.........))))).).)).....))))).)))))(((....))))))))))).((((......))))....(((((((((..(((((...)))))(((((.........)))))..((((..((((((((((((...(((.(((...(((((......))))).........))).))))))))))....))))))))).))))))))).(((((.((....))))))).........(((((((.....((.(((((.....(((((......))))).((..(((((........)))))..)).((((..............)))).......))))).))..))))))).....(((.....)))((((((.......))))))((((.....))))))))))))).....(((((((((((.((((...))..)).)))))))....))))..(((((....((...(((((((........)))).)))...))....)))))....((((..(((((.(((.((((((.(.((((..(((((.((((.((..(((((.((((((((((((((.((((((.(((......((...(((((....)))))))..))).)))))).))))))))).(((((((((.(((((((((((.(((..(((....)))((((..(((........)))..)).))...((.(((((.....))))).)).........(((...(((((.(((((.....))))).))))).....)))))).))).))).....))))).).))))...))))......................((((((.((((.(((..((((((.(((.((((((((...((.((..((.((((((.(((......))).)))))).)))).))...))))))))...((..(((..(.(((((...))))).)..)))...))............(((((((..((((.........))))..))))))).))).))))))..))).)))))).))))...))).)).)))))..))..))))))).))..)))))))))))..)))..))))).))))(((((((((........((((.........((((.(((...))).)).))..(((((.((..(((((((.(((((.....))))).))))(((((.((.....(((...))).....)).)))))..(((.(((.(((((.((((...((((.((............)))))).....)))).))))).))).))).......)))..)))))))...))))........)))))))))................))))))....
Thermodynamic Ensemble Prediction
..(((((({((((((((...({(((((,.,|||}|......|,)}}}(((((((((.(((((,.,.(((((.......))))).(((.((..............)).))).((.{.(((((.........))))).}.))....,))))).))))))))....||{|||||||}{((((({.{(((((...)))||}}|}))))|,,{{{{{{||||{((({..,...,,,|||||{{{{(({,((({((((((((...{{(,(((..,(((((......))))}..,...,.,))}.}}}))))))).,..}}}}}...|||||||||||.(((((.((....)))))))..||{,,..(((((((.....{{.(((({.....{{{{{,{,{,,||||}.((..(((((........)))))..)).(({{..,,,.........))))...}}}}))))).))..))))))),|||||{{,...})))||||||,.|||||},,}}}((((.....)))))))))}}}}.....{((((((((((.(({{...}}..}).)))))))....)))}.,((((|,...,,...(((((((........)))).))).,.}).,},))))).,..||{{,,{|{{{.{||,||{|||.{.((((..(((((.((((.{{..(((((.((((((((((((((.((((((.(((.,....{{...(((((....))))))),.))).)))))).))))})))).{{(((({((,((({{(({{..,(((,,(({{..,||}|||,.|||.|,|,...,||}..||{||...((.(((((.....))))).))....,,...(({,..(((((.{((((.....))))).))))),}}},|||,.{{..,.|,},..,))))}},).))))...}}}},,..,..,,......,,.,,..((((,({((((.(((..((((((.(({.((((((((...((.{(,.{(.((((((.{((......))}.)))))).)}}).))...)))))))).....,,((,..(.(((((...))))).)..}||.||}}...,,,.,|{{{((((({(,{{{{,....,,,.}))))}.,}))))).))).))))))..))).))))))}})))...)}).)).)))))..}}..))))))).)).,)))))))))}}..)}}..}}})}.)))}{((((((((........{(({......,..,|{|.{{,...,)),}).}}..(((((.((..(((((((.(((((.....))))).))))(((((.((.....,,{...|||.....)).)))))..{{(.{({.(((((.{(((...{{{{.(({{....,},,..,,}}}}.....}}}}.})))}.}},.))}.......)))..)))))))...)))).....,..)))))))))...,.....}},,,..))))))....

Transcripts

ID Sequence Length GC content
ACCGCAGCGGACAGCGCCAAGUGAAGCCUCGCUUCCCCUCCGCGGCGAC… 1491 nt 0.5895
Summary

The product encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. Mutations in this gene cause a variety of myopathies, including nemaline myopathy, congenital myopathy with excess of thin myofilaments, congenital myopathy with cores, and congenital myopathy with fiber-type disproportion, diseases that lead to muscle fiber defects with manifestations such as hypotonia. [provided by RefSeq, Sep 2019] CIViC Summary for ACTA1 Gene

Forensic Context

A study in rats demonstrated that heat exposure induces cardiac overload and damage, with mRNA expression of the ACTA1 (Acta1) gradually decreasing in both the atrium and ventricle for up to 2-4 hours post-exposure before returning to control levels by 8 hours [Nakagawa et al. DOI:10.1016/J.Legalmed.2011.12.001]. This reduction, alongside rapid increases in Nppa and Nppb and later increases in Myh6 and Myh7, indicates early myocardial dysfunction, with immunohistochemical detection of fibronectin-positive cardiomyocytes confirming subsequent structural damage.