Basic Information

Symbol
CBL
RNA class
mRNA
Alias
Cbl Proto-Oncogene RNF55 C-Cbl CBL2 Cas-Br-M (Murine) Ecotropic Retroviral Transforming Sequence Cbl Proto-Oncogene, E3 Ubiquitin Protein Ligase Casitas B-Lineage Lymphoma Proto-Oncogene RING-Type E3 Ubiquitin Transferase CBL E3 Ubiquitin-Protein Ligase CBL Signal Transduction Protein CBL RING Finger Protein 55 Proto-Oncogene C-Cbl Oncogene CBL2 Fragile Site, Folic Acid Type, Rare, Fra(11)(Q23.3) EC 2.3.2.27 EC 6.3.2 FRA11B NSLL
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_005188.4
Sequence length
11168.0 nt
GC content
0.4553

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3505.62 kcal/mol
Thermodynamic ensemble
Free energy: -3701.32 kcal/mol
Frequency: 0.0000
Diversity: 2723.62
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........(((((.(........(((.(((((.(((((..((((((.(....((((((((.........))))))))..).)))))).(((.((((((((((((((((((..((((((((...(((((.(((((((.((((...(((((..((..((((((...(((((...))))).)))).))....))...)))))...)))).)))))))..((((((....))))))((((((.(..((.((((((((..((((.((.....(((((((((((((((..((((.........(((.(((.((((.....))))))).))).((((((((.....)))..))))).......))))..)))))))))))))))(((((((((((((((((..((((((...(((((.((.((...(((((((((((((.((((......(((((((((((((..((.........))...(((((((((((.(((((.((((.((((((.(((....)))....((((.....))))........((((((..((((((((.....))))).))).......((((...)))).)).))))..(((((((((((((.((((...((((....(((((.((((...((....((((((((.(((((((((..((((((.....(((...)))(((((((.....))))))).(((((..(((((((((....((((((((.((((((((.((((..((((........(((((...........)))))....((((.....((........)).....))))...)))))))).))).)))))..))))))))..))).(((((...)))))(((.(((((((((..((.(((.......(((((....((((((..((((((.((((((.(((((((.......((((((((((((((((...((((..((((.((((....)))))))).))))...)))))))..)))))(((.((((....((....))...)))))))....................((((.....(((((((..((((.((.((((((..((((((....)))....(((((....)))))......)))..))).)))))...)))).))).)))).....))))...))))......)))))))...))).))).)))))).))).)))....))))).........(((((........(((((((((.(((.((....((((.(((.....))).))))))..))))))))))))(((((((((((((((((((((((.(......).)))..............(((.....)))..(((((((.(..(((..........(.(((((.((.(((.(((.(.(((..((((..(((((....)))))((...(((((((.((.((..((.((.(......).)).))..)))).)))))))...))...((((....))))((((((.....))))))........))))...)))).))).))).)).)))))))))..).))))))).)))))))))))..((((.((((((.((......)).))))))))))((((((((....))))))))..(((((((.(((...((.......(((((....(((((((((((.(((((...((((.(.(((((.(((((((((..((.(((((((((((((((((((.........)))))(((((.(((.((..((((((........))))))..(((((((((((((((...(((((..(((((.((((.((..((((((.(((((((((((((...((((((((((.....((((((....(((.....(((((.(((((((((((...(((((.((.....((....))...)).))))).........(((((((((.((((((.((((((..(((((((............)))))))..))))))....))))))...........((((((((((.((((((...(((.((.................)).)))...)))))).)))).............)))))).....((((((..(((.((....)).)))..))))))...)))))))))(((((((.....((((.....)))))))))))..((((.....))))(((((.......)))))..((((......)))).(((.....)))((((((....(((((((........)))))))....))))))))))).)......))))).).)))).)))...))))))..))))..)))))))))).)))))........)))))))))).)).)))....).)))))..))))).((((((....((.....((.((.((((.....)))).))))....))....))))))......(((((((........))))))))))))))))).)).)))............(((((((((((....((((((((((.((((...............((((((((......)))))..)))...((((((....)))))).((((.(((((...((.......)).))))).)))).(((((.((((....(((((.........)))))))))..)))))..((((...))))............((((((((((.....((......))..)))))))))).....))))))))))))))............(((((((((.(.(((((((............(((((.(((((.(((((...))))).)).))).)))))...........)))))...)).).)))))))))..)))))))))))..(((..((((((((((.((.((.(((((....)))))..)).))...))))))))))..)))(((((((((...(((((((.......))))))))))))))))))))))))))......((((((...))))))((((((..((((.....(((((........)))))......))))...))))))..(((((((((((........)))..))).))))).....(((((.((((.........)))).))))))))))))))))).)).)).).))).......))))).))....((((..(((((...((((((.....((((((((((((((((((......)))))))))))..........(((.(((((((((....))))).)))).)))...((((((.((((.(((((...(((((..............)))))....)))))..)))).))))))..)))))))...))))))........((((((((...........................................)))))))))))))))))((((((((.(((.(((((...........))))))))))))))))))).).))))....))))).)).)))))))))..)))))(((((..((((((((((..(((...(((((((...(((((..........))))).)))))))....)))..)).))))....))))...)))))((((..((((((((.........))))))))..))))...............))...))).)))))))..........))))).))))(((((((((......)))).)))))))))).))).))..)))))).))).)))..))))))..))))).))))))...))))).(((((((((((.......((((((((((.(.((((((((........))))))))))))).)))))).((.((.((.((((((((.........)))))).)))))).))......(((((((........(((((((((.....)))).).....)))).........))))))).((((((......(((((((...((((((((......(((((........)))))(((((.......)))))((((.((((((.....))))..)))))).......))))))))..((((((.(....(((.(.......).))).....).)))))))))))))......)))))))))))))))))....((((.......))))..(((((((((((...(((((((((((.....)))))))))))(((......((((((.....))))))..)))...(((((((((((((.((((((.....)))))).))))))))....((((((((((((((((((((((((((.......))))))))))...))))......)).))))).)))))..........))))).)))))))))))(.((((........)))).).))))))))))))..))...))))...)))))...)))))))).))))))))))))).......)))))))))).)))))...(((....))).....)))))))))))..))))))))...........))))).(((((((........)))))))...((((((((((.....))))((.(((.((((((..(((((...(((((((...((.((((.....((((.((((((((...((((..((((..((((((.((((((((......((((((.......))).)))......))))))))(((((((....)))).)))........((((((((((.(.((((((((((..((((((.((..((........))..)).)))))).......(((((.((((......))))........(((((((.......(((((((..((((((......(((((.(((((.(.(((((((((((.......((((....(((((((((((...............((((((.((((((.......))))))..))))))...(((((.....)))))...(((((((((((.....(((((...(((((.....(((((((...))))))).....(((((...)))))..((((((...(..(((((..........)))))..)....)))))).......))))).....)))))..((((.......)))).))))))).))))...))))))))))).....))))...(((((((..(((..(((..((((((((((((.((.(((.(((((((((.........(((((((.(((....))))))))))((((.((((((.......))))))))))...((((((....((((.((((...(((((((((....))))))))).................((((((....((((((....(((...((((........((((....)))).......((((((...)))))).....))))....)))....)))))).....))))))...........((((((..((((((((......))))).))).....)))))).(((((((((.............))))))))).....................(((((.......))))))))).))))))))))..))))))))).))).))...))))))..)))))).)))..(((((((((...)))))))))(((....)))(((((((....((((.(((..(((((((..((((..(......(((((.(..((...))..).))))))..)))).))))))).))).)))).....)))))))..........)))..)))))))..........((((((((((.(((((((((((((((((..(....)..)))))))).......(((..((((....(((....(((((((...................(((........)))(((........))).((((.....))))((((((....))))))..............)))))))....))).....))))..)))))))))))).))))))))))...(((((((.......((((((....))))))....(((((((..((((((((....(((.....((.(((((((......)))))))...)).....))).))))))))..)))))))...)))))))))))))))))).).))))).))))).......))))))))))))).......))))))).((((((..(((((((((.((((((...........))))))............(((...))).)))))))))....))))))..)))))........(((((((....)))))))(((((.(((((((..(((((((.(.....).)))))))..))).)))).).))))..(((((.((....)).)))))(((((........)))))....(((((...))))).((((((((((..((((((((((((((...(((((((((((....(((((..(((((((...........(((((((((((((.......((((..........(((((((((((((((((.((((...((((........))))((((((.((((((((((((....((((.(....)))))...)))))....))))))).).))))).((..(((((...)))))..))(.(..(((((((((((....)))))))))))..).)....)))).)))))..)))))))))))))))).))))))))))))).(((((....((((((.....)))))).))))).(((((((...(((.........((...(((((((..((((.((((((.....((((((((..(.(((((((((((((............(((....))).......((((..(((..........)))..))))..(((((((((((((((...((((....))))..))))...)))))))))))((((.((((...(((((.(((((....))))).)))))..........(((.((((.....)))).)))..((((........((((((......)))))).......)))).)))).))))..)))))))..)))))).).))))))))((((((((((((.(((.................)))))..))))))))))))))))..........(((.....))).....(((((..(((((((.((((((..((((.......))))..(((((((....))))))).......(((.....)))))))))))))))))))))..(((.(((((((((......))))))))))))..((((((...))))))........)))).))))))).))......)))))))))))))))))..)))))))))))))........((((((.(((((.....)).)))..)))))).(((.((((((((...(((((....))))).)))))...))).))))))..)))))))).....)))))).....)))))))))).((((((((((..........................(((((((.(((..(((((....((((((..........................))))))....)).)))..))))).))))))))))))))).((((((.(((....)))))))))..)))))))))).)(((((...((((....))))...))))).(((((((((((((......(((....)))......)))))))).............((((.(((((.((......))))))).))))((.(((((.(((...........))).)).))).))..))))).............(((((.((((((.(((.(((.........))).))).))).))).))))).......)))).)))))).))))))...))))..))))))).))))).).))))))))).)))))))))))))))))).))).))((((((((..(((.(((.((....)))))))).)))).)))))))))))))).))))))))))))).(((((.((((.....)))))))))((.(((((((((((((((((....)).)))))))))..))))))..))...(((((...(((((....((((((...))))))))))).....))))))).)).)))))))))))))))))))))))..))))).)).))))..))))))))))..).))))))))))).))).)))))))))))))))).(((((...(((((..((........))..))...)))...))))).......))))))))))(((...(((((........))))).))).))))).))))))))..........(((((....)))))....((((..((.(((((((((((.((((((((((((((((((((((..((((..((((((((((((((..(((((.(((........))).)))))..(((((((((.....((((.(((...((((....)))).))).))))......))).))))))(((((...........)))))((((((((((((((..(((..............(((......))).(((((((((...)))))))))....((((.....)))).)))..))))))))))))))..((((((((.......(((((((((........(((((.....)))))...((....))........(((....)))................(((((........)))))..((((((((........))))))))...)))))))))......))))))))...((((((((.......((((.....)))).......)))..))))))))))).)))))))).....))))...)))......(((((.....((((((((.(.(((.(((((((.((((.(((((.((((((.(.(..(((((.((((((((((((((((.....((((....))))...)))).)))))))))..((.(.((((((.......((((((((.(((((..(((((..((((((((((.((...)).)))....(((((....(((((((((...(((((((((((.((((......((.((((......)))).))........)))).)))))))(((((.....((((.....((((((((..((....)).)))))))).....))))...)))))...(((((..((((.....)))).))))).(((((.....)))))............((((((((((..........)))..)))))))...)))).)))))))))....)))))..........)))))))....)))))..((((.(((((((.....(((((((..(((.((..........)).)))))))))).(((.....))).))))).))))))((((((...)))))).....(((.((.((.....)))).))))))))))).)))))(((((.(((.(((..((...(((((((((((....)))))))))))....)).)))))))))))..)))))).).))......))))).)))..).)...)))))))))))))))))))))).))).).)).))))))))))))))).))))).))))))...(((((((((.((..(((((((..(((.(((..(((((((..(((.((......)).))).))).....))))..)))))))))))))....)))))....))))))............(((..((((((((((((..(((((((((((..............................((((((((.(((((((....)))))))...............))))))))(((((...)))))(((((....((((((((((.((((((((((((((((.(((.......((((((((.(((((((((...(((((((((.(((.......(((..(((((((........)).)))))..))).(((((((.(((.(.(((((((...))))))).)))))))))))...))))))))))))..)))))))))..((((.((((....((((((((......))))))))...)))))))).......((((.....))))(((((........)))))((((........))))(((((.....))))).....((((....(((((..(((((..((((((.((((....)))))))))))))))..)))))))))(((....)))..((((.(((.((.(((.................(((((.((......))))))).......))))).)))))))((((..(((...))).))))(((((((.....)))))))))))))))...((.....))((((((.(((((....))))))))))).....(((((((((....(((((....(((((.((....))))))).((((((((.(.(((((.(((((((....)))))))..)))))...).))))..))))..)))))..)))))))))....((((((....(((((.....)))))....)))))).................))).)))).))).)))))))))...)))))))))))))))(((((((.........)))))))......)))))))))))...........(((((.................)))))((((((((((........((((((((...))))).))).((((((((((...))))))))))..............))))))))))...((((((.(((((((((...((((((((..((((..(....((((((...((((((..((((.......))))..)))))))))))))..))))..))))))))....)))))))).....).))))))...................))).)))))))))..)))....)))).))))))))))).))..))))((((((....))))))(((((((....)))))))).))))).
Thermodynamic Ensemble Prediction
.........(((((.{........(((.(((((.(((((..((((((.{....((((((((.........))))))))..}.)))))).(((.((((((((((((((((((..((((((((...((({(,(((((((.((((...(((((..,{..((((((...(((((...))))).)))).),.,,......)))))...)))).)))))))..((((((....))))))((((((.(..((.((((((((..((((.((.....(((((((((((((((..((((..,......(((.(((.((((.....))))))).))).((((((((.....)))..))))).......))))..)))))))))))))))(((((((((((((((((..((((((...(((((.{{,((...(((((((((((((.(((((..{{{({{((((((((((..((.........))...(((((((((((....,,..{{,.{,((((((,({....,,.,..((((.....))))........,|||}}}}|||{{,((({.....)))},}}.......(((,...})))..,,}}},..(((((((((((((.((({.,{(((,,...(((((.,|||.,,||,,..(((((((((((((,,(((((...{,{....,})}}|,|||(((((((.....})))))).,,{{{,{{({,(((((((((((((((((.((((((((.(((,.,((({........(((((...........))))}....((((.....((........))...,.))))...}))))))).))).)))))..))))))}|..,|,.(((((...)))))..|.,,|||{||{,..(((((((..(((((.((.(((({{(((..(((((((((,,((,......,,.......,))}.,,.....,}}...))))))))).)))))))))).))))).))))))),||||,,||,,,{|}|||}||||.,,||||||,||,...||||{{,..,,....{{{{{{,,,,{((((((.{{{{((({((((((((((.,{({{(({,,.{{{.,,.))).,,,|{{||....))}}),,||..{({{{{{{,,,,,{.,,,,,,||||{{{{{{{{...{{|{(({(|{.{{{,((({..,||||.}||,.{,||||.,.,|||||,..,|,,|||,,.,}}}}}|{{|{........((((((({{{(((.{{{...((((.(((.....))).)))),}}.))))))))))))((((((({{(((((((((((({,.{.,,,{{|,|||,,,,.,.......,||{},.,.,}},.{((((((.(..(((...,......{,(((((.((.(((.(({.(.(((,.((((.,((((({{..},))),|,..(((((,{.,|.||}.||,{{,{..,||,}.||.,,..|}}|{||}},})|||)}...{(((,.,.||||{(((((.....)))))),..,,.,.)))).},))),,))).))).)),)))))})))..).))))))},}))))))))))..((((.((((((.((......)).))))))))))|||{{{{,....)))}}))),,|{{{{{,,|{{,,,|{.....,,(((((,,..(((({{{{{{{.(((((...((((.{.((({{.(({({{((,..((.((((((((((((((((,{{.}}}}},}.,,|||((({,{(((,({..{(((((.{....,.)))))}..(((((((((((((((...(((((..,((((.{(((.(,,.((((((.(((((((((((((...((((((((((......,,({{...|||(((((.((..((((......(((((((((((((......,,....||{{.......,,........}|||(((({..((((((.((((((..(((((((,{......,,..)))))))..))))))....)))))),,}...{{,,.(((({{((((.((((((...(((.{(,............,,..)),}}}...)))))).))))....,,,,.,,,,||}}}),,,..)))))))))).))}..))))..)).))))),|{..|||||||}|(((((((.....((((.....))))))))))).,{{||,,...)))||((((.......))))}}.{{{(,.....)}||,.(((.((.,..((((((....(((((((........))))))).,..)))))).,.))))).,,,..{(((({{{,|......})))))))}.))))..))))))))))))})))........)))))))))).),,)))....).))))}..))))).((((((....{{.....{(.((.((((....,)))).))}}....,,....))))))......(((((((........))))))))))))))))).)).))}............(((((((((((....((((((((((.((((............,{,({{(((((......)))))..}))},.((((((....)))))).{(((.(((((...((.|,....)).))))).))}}.,,{{{.{{({.,..||}))...{{{.{((({.,,.....))))).}||,,...,||,...}}.......((((((((((.....({......}}..)))))))))).....))))))))))))))............(((((((((.(.(((((((............(((((.(((((.(((({...})))).)).))).)))))...........)))))...)).).)))))))))..))))))))))).,(((..((((((((((.((.((.(((((....)))))..)).))...))))))))))..))){((((((({.,{(((((((.......))))))))))))))))}|||}}}|||,,...,((((((...)))))}(((((({.((((..,..((((({......,)))))..}...)))).}}))))})..((((({((({(,,......})),.))}.))))).,{(((((((.((({.........)))).)))),)))))))))))).}).}).}.}}),.,|,..))))}.}|....{{{(,,(({{,.},|||{,,.,{,.{{{,,,((((((((((((......)))))))))))}..|||,..,(((,((({(((((....))))),)))).}}},{,((((((.((((.({(((...(((((,.............)))))...,}}}))..)))).))))))},}}}}}}|..,}}}}}|,|,....,(((((({{....,..}},,,..............,,..,,..,.,,,....))}}}}}}}}})))))|(((((((,,(((.(((((.,.......,.))))))))))))))))))).).))))....))))).)),))))))))),,))))){((((..((((((((((..(((...(((((((...(((((.|......,.})))).)))))))....)))..)).))))....))))...))))|((((..((((((((.........))))))))..)))),..............},...))).})))))),,,.......))))).})))(((((((((......)))).))))),))))}}))),))}}}}}))))}).))},}},})),))))}|||||}..,,.,,,,,..(((((((((((,,,....((((((,{((.(.((((((((........))))))))),))).)))))).,,,||,{{.((((((((.........)))))).))}}}}.}}......{((((((........(((({((((.....)))},}}....)))).........})))))}.((((((......(((((((,..((((((((,.....(((((........)))))(((((,{...,,}}}}}(((({({{(({,....))))..)))))).,,,,,,))))))))..{(((((.{,,,.(((.{.......).)))....,}.)))))))))))))......)))))))))))))))))....{{||,,,.,,,)))),.,{{{{{{{{{{.{.(((((((((((.....))))))))))),||,,,}.}|||||,.....}}}|||,.,,....{||||{(((((((.((((((.....)))))).)))))))},|,,||{{||||||{{{{||{{||{{{{((.....,.}))))))}}}...)))),.....)}.)))))}}|}}},,,,......)))}}.)))))))))))|.{|{{......,,)))).}.}))))))))))).{||,{,||||...})))).}})))))})).))))))))))))),{(((({.{{......))..)))))}},,....|,...,,.)))))))))))..)))))))))}...},,...,.....{((((((........))))))},,.(((((({(((...,,||||((,{{(,(((,,,.|||||....{((((((..,({,((((.....(((({((((((,((.,({((,.({{{..{|||{{.{(((((((..,...(({((({.......)),)))......)))))))}(((((((....)))).))){{{...(({((((((((((((({((((((((..((((((.((..{(........))..)).))))))..}}}}}....|}|{(,{{{{{.|||}...,,,..(((((((.......(((((((..((((((....,.(((((.(((((.(.(((((((((((......{(((((({,({{(((((((.{{{,{,.,.,,,,,,(((({(,((((((,,...,,||||}}{{|||||,...|||||}}..,}}|||,...((({(((((.....,((((({.,(,((({,...,{{{{{,...|||||},.,},,|,{{,.,,)))))..||||||},.,..(((((..........))))).,),,})))))}},}.....},|||{{{{{{|,||{{{(((.{,.,{.|,||.{||},,,.))))..})}))))),)))).))})))}.,,|||||||,,||||.{{(,,((((({,{{(((,{,.,{(,,(((((,{{.|}}}}.},(((((((.(((....)))))))))){{{{.((((((.,....,)))))))))).,}||||||}}..||||,||,,...(((((((((....))))))))).................((((((.,..((((((....{,,...,,.,........((((....)))).......((((((...))))))....,)}},....,,,....))))))...,.))))))....,|,....((((((..((((((((......))))),))}.....)))))).(((((((((.............)))))))))................,,,.{(((((,,,....))))))))),,)))},,}}}.})))))),,,.)))})))}}),,|||{{||||}|,|||,|{((((((((...))))))))|(((....)))|{{{{|{,,..{({{.(({..(((((((..((((,.{,.....{{{||....{{...|}....)))))}..)))).))))))).})).}))),.,.,))))))),........,|||..,,,})))..........((((((((((.(((((((((((((((((..(....)..)))))))).......(((..((((....(((....(((((((...................,.,........))}(((,,,....,)))}((((.....))))((((((....})))))..............)))))))....))).....))))..)))))))))))).)))))))))},,.{{{{{{{.......((((((....))))))....(((((((..((((((((....,{{......,.{{{((((,.....}}}}}}}...})},,,.},,.))))))))..)))))))...}))}}}}))))))))))).).))))).)))))..,,...))))))))))))).......))))))).((((((..(((((((((,((((((...........)))))},,,.........(((...))).,))))))))....)))))).{{((({........}})))|{,{{{{,|,,,((((((.(((({((,.{((((((.(.....,,))))))),,)}}.)))).).))))).,,|.}))}}},}.},)}}.)}}}},||....{|||.((((((((((((,..{{{..,{,.(((((((..(.(((.((,,((,((.(({,(((((((((..........(((((((.((((,....(((((((({({{{.,..,.,{((({,.....,,.(((((((((((((((((.((((...((((........)))|((((((.((((((((((((....((((.(....)))))...))))),...})))))).),})))),{{..(((((...)))))..}}{.{..(((((((((({....}))))))))))..}.}.,..)))).)))))..)))))))))))),))..})))))))))))).{((({,...,{{{||.....,,||||{|,,||{(((((({{{((((..,.,..,.{{...(((((((.,((({.((((((.....((((((((..,.(((((((((((((............(((....))).......((((..(((..........)))..))))..,((((((((((.{.({{.(({(,...,,)).,})))...))))))))))|((((.((((...(((((.(((((....))))).)))))..........(((.((((,,,.,}}}),)}),.((((........((((((......)))))).......)))).)))).))))},)))))))..)))))).).))))))))(((((((((({(.(((.................)))}}..}))))))))))))))}..........(((.....))).....(((((..(((((((.((((((..((((.......))))..{{((((({..{,,,,,,)},,}},,(((.....)))))))))))))))))))))..{((.(((((((((......)))))))))))}..((((((...))))))........)))).))))))).))..,...)))))))),)))))))))),,,))))))}{|||,,,,|.|,{{{{{.{{{{{}.,,,))}))),.,}}}}))))).))))))))))).)))))))).)))))).))),)..)))))))....,.)))}})}}.......)))))))),})))}..},||||||||{.|||}}},}}.,,||}..,|,||,}|||||||||,.....||{......,,,,,..,,,|||{.{{{{{............}})))})))}}....)})}))..)},,)))}}||||}||,((((((.(((....)))))))))..}}})))))))}.(((((...((((....)))).,.)))))...||||||||||{.....,(({,,,,|||,,.,..}}}|||}}.............((((.(((((.((......))))))).))))||,{((((.{{{......|,...})).)}.}}}.},..|||}|{{{,,{...{{{,(((((.((({((,(((.{{{..,,,,,,.))}.}}}.))).))).))))}.......}},,.,,}}},.})))))...}}}}..}}}}}},.))))),}.))}||||}}.)))))))))})),)))}),))),))||{|||{{.,|||||||,{|,,.,|||||}},,))))}))))))),,))))).))))))))))))).(((((.((((.....))))))))),,.(((((((((((((((((....)).))))))))),.})))))..}|..,{((({...(((((....((((((...)))))))))))...,.))))))).,,.)))))))))))))))))))))))..))))).)).))))..))))))))))..}.))))))))))).))),)))))))))))))))).(((((...(((((..({.,.....,))..}}.,,)))...))))).......)))))))))){,{,,.(((((........))))),))}.))))).))))))))..........(((((....)))))....((((..((.(((((((((((.((((((((((((((((((((((..((((..((((((((((((((..(((((.(((........))).)))))..(((((((((....{((((.(((...((((....)))).))).)))),}....)))}}))))),,{{{..,..,,....}}}}|((((((((((((((,.(({.........,.,..{((......))}.(((((((((...)))))))))..|,((({.....)))),))),,}))))))))))))),.|,,{((({..,,...((((((,,.........|||||.....)}})),,.{(....}}.,}.....(((,,..|||..,,.,,.,,,.....(((((........)))))..((((((((........))))))))...,,|||||,,.}}},,,,}}}}||...{{|||..,...,,,,||.,.......}},...,}}),,..,})},))))))},)))))))....,})}}...))).,,,.,(((({,....((((((((.(.(((.(((((((.((((.(((((.((((((.(.(..(((,({({{(((((((((((((..,..((((....)))),..)))).)))))))))..{,.,.{{((((....((((.(((((..((((....((((((((((((((((.({...}}.}}}....(((((,...(((((((((...(((((((((((.((((.{....((.((((......)))).))..,,.,..)))).)))))}}{((((.....((((.....((((((((..{,....,,.)))))))).....))))...))))}...(((((..((((.....)))).))))).(((((.....)))))............((((((((((..........)))..})))))).}})))).)))))))))....))))))))))).))}}},)))....))))....,{{{.((,(((({{...(((((((..(((.{,..|....,..}}.)))))))))).|||}}}.}),|,|||}}.|||}},((((((...)))))).....{((.({{((.....)))).)))))))))))..}}}}(((((.(({{(((..{,.,.(((((((((((....)))))))))))....),.)))))))))))..||||},.,.,},.....))}))})))..).}...)))))))))))))))))))))).))).).)).))))))))))))))).))))).))))))...(((((((((.((..(((((({,,(((.((({,{(({(((..(((.((......)).))).)))....,))))),)}}))))))))))....)))))....))))))............(((..((((((((({((,..{((((,,,,,.................,,,..........,,((((((,((((((({{{{|||,,|{{,.,,,,..{{{{{,,,,)))),||{{|...}}}||(((,(({...,,||||||}}.....,((((((((.{((((({{....(((((((((((({{{(({,{,||(((({,{{{{({,,...,(((,{(((((((,{.....,||{}}|||{,|||,(((((((.(((.(.(((({((...}},})}}.}}))))})))|.,,||{{|||||||||}}})}|))}||,{(((|||((|.|.((((((((......)))))))).,,))}},}}},}}},.})))..)))},,)))})))))).,...,}}),|||,}}}}},},{{((((((({..{{{,|(({....}))}}}}((((((..(((((..((((({,((({....}))))))))))))))..))))))|||,,,,}|{|||{{(((({(({.((,(({..{(((,.........,(((((,({......))))))).|,,.{{|||{,.,|||,|(((((..{{,...,}).)))))((((((,....))))))....|.{{{{,....,}}})}{(((((.(((((....))))))))))},,,...||||{|||}}}.,|||,....{|||||||....)}))))},|||{{{{{.{.(((((.(((((((....)))))))..)))))...,,))),.,)))).,})),...))))))}))},|,((((((....(((((.....)))))....))))))}{({{{((((((((((............)))))))))))))}.,)))))))))),(((((((((.......}.)))))))))..,,||||}}},},,..{{,......{((((.................})))}((((((((((.....,{{((({{{{{...|}}}}.})).,(((((((({...}))))))))}............,,))))))))))...|,,||,,.,||||,,|,,,||,,((((||{|||}}}}}}}|,,}}}}}}.,|||}}}}}}}}})).)))))))).,}}}.)))).,)}}))),..,,})))))}}}}),)))))).,|,{{{,....},,}}.........,.....}},.)))))))))..)))....)))).))))))))))).))..)))){{((({....,))))}(((((({....}))))))}.))))).

Transcripts

ID Sequence Length GC content
CUUCACGCCCUGCUUCUCUCCCUCGCUCGCAGUCGAGCCGAGCCGGCGG… 11168 nt 0.4553
Summary

This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016] CIViC Summary for CBL Gene

Forensic Context

No relevant information is available at the moment.