Basic Information

Symbol
CBLN1
RNA class
mRNA
Alias
Cerebellin 1 Precursor Precerebellin Cerebellin-1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Forensic psychiatry evaluation

MANE select

Transcript ID
NM_004352.4
Sequence length
2442.0 nt
GC content
0.5450

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-937.80 kcal/mol
Thermodynamic ensemble
Free energy: -978.41 kcal/mol
Frequency: 0.0000
Diversity: 524.54
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((((((((.(((((((((((.((.........)))))))..)))).)).)))))..)))).)))))).))))(((((((..((..(((((.(........((((((.(.((.((......)).)).).))))))((((((((.((((((((((((((((((((((((((((((.((((((((..(((((..(((...(((((....)))))....)))((((((((.((((((((..(((((..(((((......)))))(((.((((((((((.(((((....(((((((((((((((.((((((((((((((.(....)))))).(((((((((((((((((.(((((((((((.((((.......(((.(((.(.(((....))).).))).))))))).))))))..))))).)))))(.(((((.((((.(((((..(((...(((((((((((.(((((((.(((.((..(((...........)))..)).))))))))))))))))...((((((.(((.(((((((..((.((..((((((.......)))))).)).)).....))).)))))).).))))))......((((((..((.........))..(((((((((((.((((((((((((.......(.(((((..((..((.(((((.(((((((........((.(((....((((.((((((..(((((....((((.....))))..)))))...((((.(((((.((....((((((.((((((((.........)))))))).)))....)))....)).))))))))).((..(((.(.(((..(((....)))...))))..))).)).(((.((.((((....((((....))))......)))).)).))).((..(((((.((...((((((......(((((((..((((((...)))))).)))))))))))))...)).)))))..))...)))))).))))..)))))........).)))))))))))..)).))..))))).))))))).)))))).)))...)))))))).......))))))..))))).)))(((((....))))).((((((....))))))......)))))))))..))))).).))))))))))))...........))))))))).))))))))(((((..((......)).))))).......)))))))....)))))..))))).))))).)))................))))).....)))))))).........)))))))).)))))))))))))..(((((((((((.((...((((((.(((..(((((.(..((((((((((((((((......)))))))).))))....))))..).)).)))..))).))))))..)).))))))..(((((((((((.(((((...........)))))))).))))))))..((((((.(((((...))))).))))))(((....))).....))))).(((((.....)))))............((((((((.......))))))))..((((....)))).((((....)))))))))))))))...................((.((..(((((...((..(((..((.(((((...((((....))))....))))).)))))..))...))))).)).))..))))))))))))))..))))).............(((....)))(((.(((.(((((((.(((((((((((......))))).)))))).))))))).))).))).((((....))))..............(((((((((....)))))))))...)))))))).....((((((........((..((((((((.(((((.........(((((.((((((((.((((((....)))))).....((((((.((((........)))).))))))(((((..((((.((....))..))))(((.(((((((.(((..((((.....))))..)))...(((((...((((.((((....))))))))))))).))))))))))....(((((.((((((...))))))..)))))..))))).(((((......)))))((..(((((......)))))..)))))))))))))))))))).)).))))))..)).......)))))).).)))))..)).(((..(((.....))).)))(((((....))))).....)))))))....((((((.....(((........)))(((..(((((((((((((......)))))))........((((((((...))))))))....))))))))).((((((((.........))))))))..))))))..
Thermodynamic Ensemble Prediction
{{{(((((((.{(.(((((.(((((((((((.((.........))))))))))}})}))})).||||||||,|||||}.||||((((,{({.((..(((((,{,.{{.,,.{(((({.{|({.{{....,,|}|}}.}.))))))((((((((.((((((((((((((((((((((((((((((.((((((((..(((((,{(((...(((((....)))))....)))||((((((.((((((((..(((((..(((((......)))))(((.((((((((((.(((((.,..((((((,((((((((.((((((((((((({,(....)))))).(((((((((((((((((.((((({((({(,(({(.,,,,..(((.(((.(.(((....))).).))).))))))).))))}),,))))).)))))(.(((((.(({(,((((((((({,,.((((((((((,,(((((({,(((.((..(((...........)))..)).))))))))))))))))...((((((.{,({(((((((..(,{((..((((((.......)))))).}).)).,...))).))))}),,.))))))......((((((..,,...,,....,}}.(((((((((((.((((((((((((....,,,{.{{{{{..,.((((.(((((((((((((((.....{(({..,...,,....,,|}}}..(((((....((((.....))))..)))))...((((.(((((.,{....((((((.((((((((.........)))))))).)))....)))....},.))))))))).{{..(((.(,({{..(((....)))...})))..))),||...,,,,..|}},}.)))))).....))))))))))))),.,,,.(((...(((((((...((((((.{.,{((((((((..(((.(((.,..||....)}))).))),,)))))).))}},))))))..)))).)))...))),))},..|{{||.,|{(......,,.)).}..})))}...)))))).)))))).)))...)))))))).......))))))..))))),))))),,..,}}))))},|{((((....))))}|......,)))}}}}}..))))).).))))))))))))...........))))))))).))))))))(((((..((......)).))))).......,))))))..,.)))))..))))).))))).)))................))))).....))))))))..}}}....}}})}))),)))))))))))))..{((({((((((.((...((((((.(((..(((((.,..((((((((((((((((.....,)))))))).))))....))))..}.)),}))..))).))))))..)).))))))..((((((((((,{(((((...........)))))))).))))))))..{(((((.(((((...))))).)))))|(((....))),....}}}}}.(((((.....)))))...,,,,.....{(((({{(..,....})))))))..((((....)))).((((....)))))))))))))))...................((.((..(((((.,.((..(((..((.(((((,..((((....))))..},))))).))}))..))...))))).)).))..))))))))))))))..)))))........,,({,,,.,,,,,},{{|.||{.{((((({.(((((((((((......))))).)))))).})))))}.}}}.}}}.({{,..,.,}}}..,,...,,,....{((((((((....))))))))}...))))))))....,((((((...,,...((..((((((((.(((((.........((({{{((((((((.((((((....))))))....(((((((.((((........)))).)))))))((,{,{((,{.((....}}|,),))||,,({{,{{.{(({..,|||.,,,.,)))|{|||....,{,||,.||||,|||,,})))((({,,(((((((.{..(((((.....,((((.((((((...})))))..)))))..(((({,...|}.)))).)))))..}.}}.)))))..))))......)))))))))))))))))).)).))))))..)).},,,..)))))).}.)))))..)).||({{((,..,}})).})))||||{..,}))},}..},})))))))....,|||||,....(((,....,..}}}(((..{(((({(((((((......))))))).,,...,.((((((((...))))))))....}))))}})).{{((((({.........}))))))}..))))),..

Transcripts

ID Sequence Length GC content
CUCCGCCCGCUCCGGCUGCAGCGCCGGCUGCAUCAAUAAUUCAGAGCGG… 2442 nt 0.5450
Summary

This gene encodes a cerebellum-specific precursor protein, precerebellin, with similarity to the globular (non-collagen-like) domain of complement component C1qB. Precerebellin is processed to give rise to several derivatives, including the hexadecapeptide, cerebellin, which is highly enriched in postsynaptic structures of Purkinje cells. Cerebellin has also been found in human and rat adrenals, where it has been shown to enhance the secretory activity of this gland. [provided by RefSeq, Aug 2008]

Forensic Context

A study in Wistar-albino rats demonstrated that the CBLN1 gene, which regulates the formation of new synaptic connections, was highly expressed within the first 12 hours following mild traumatic brain injury before being dramatically down-regulated [Colak et al. DOI:10.1016/j.injury.2012.01.021]. In a human postmortem brain study of suicide, the CBLN1 gene was found to be hypermethylated and upregulated in the prefrontal cortex of suicide cases compared to sudden death controls, and it was enriched in pathways related to synaptic plasticity [Romero-Pimentel et al. DOI:10.1093/ijnp/pyab042].