Basic Information

Symbol
CCDC6
RNA class
mRNA
Alias
Coiled-Coil Domain Containing 6 D10S170 PTC1 TST1 PTC TPC H4 Papillary Thyroid Carcinoma-Encoded Protein Coiled-Coil Domain-Containing Protein 6 Transforming Sequence, Thyroid-1 DNA Segment, Single Copy, Probe PH4 (Transforming Sequence, Thyroid-1 DNA Segment On Chromosome 10 (Unique) 170 Thyroid Papillary Carcinoma Protein H4
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_005436.5
Sequence length
5727.0 nt
GC content
0.4212

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1588.40 kcal/mol
Thermodynamic ensemble
Free energy: -1699.61 kcal/mol
Frequency: 0.0000
Diversity: 1666.28
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((...((.((((((((...(((((((((.......((((((.((((((.((((((...((((.(((...(((((((((((((((((...((((((((...((((((..((((.(.(((.(((.....(((((.....)))))......)))...))).))))).))))))....))))))))....((((((.((..((((.(......).))))..))))))))))))))))))))))))).))).)))).))))))..))))))))))))........)))).((((....))))))))).......)))))))))).)).))))((((((.(((.(((((.((((..((((((((((.........(((.(((((...))))).)))..(((((...((..(((((....((((.((.((......)).))...))))..))))).........((((((((.........(((.......((((...(((((((((((..........)))).)))))))...))))......))).........)))))))))))))))......(((.((((((............((.((((((....(((((((((((..(((((((((((.(((((((((......(((((((((....(((.(((..(((.........)))))).)))....))).))))))((((((((....(((((((((..(((((((((((.(((..((((...((((((((((..((((..........))))........((((..((((.........))))..)))).((((........((((......))))))))..(((((..(((((((((((((((..((((((.....))))))...........((((((.....(((((((.((.((((((((((((.(((((((((.((((.((.(((((.(((.((((((.((((((......((((..(((((((((((((.((..((((..(((...((((.((.....(((((...((((..(((((.(((((((((((((...((((.....))))((((((.((((((((.(.(((((((((.........))))).......((.(((.(((((((((((......((((..((((...(((..(((....)))..)))...))))....)))).(((.(((((....(((((..........)))))..........(((((...(((((((........)))))))....))))).))))))))))))))))))).))).))..(((((((...(((..((.(((((((...)))))))))..))))))))))))))).))))).)))....)))..))).........((((....)))).)))))))))))........((((...((...((.......((..........)).......)).))....))))...)).)))))..))))..)))))..))))))....)))..))))..)))))))(((((((...(((.((.((......)))).)))....))))))).(((..((((((((..((....((((....((((((((((...((((.((.(((((((((.(............(((((((.....))))))))))))))..((((((...(((((((..(((((.((((..(((((((((....)))))))))...(((.(((....(((((((((((...(((.(((....))).)))....))....)))).)))))...))))))...((((((.((((....(((((((..(((........((((......))))((((((((..((((((((((((.((((...(((..((((((....((((((((((........((((((((((((((((((((((((((((((...............))))))))((((...))))..................(((..(((((..((((((..(((((((((((.((.....)).)))))))))))(((...(((.......)))...)))(((((((((((((.((((....((((((((((((.(((((((((((((((((.....((((..((((((.(((((.....((..((((..(((((.......((((((..(......).))))))....((((((((.....(((((((......))))))).......))))))))...........))))).....))))..)).....)))))..)))..))).)))).....))).(((((....((((((((.((((((((((((((((..((((((((((.(((((((.(((..(((...)))..))).)))..))))...............((((((...((((......)))).....)))))).((((((.((((.....)))).))))))((((((((((....(((.((((((..((......))..)))))).)))..)))))..)))))))..))))))))(((........)))......))))))))))))....))))))))))))....))))).(((((((((((.(((((((((...((((.....))))...))))))...............((((..............((((((((....))))))))...(((...)))............))))((((..........)))).....))).)))))....))))))..(((.((((((....)))))).))).......((((((....))))))....))))))))))))))..))))))))))))...........)))).))...)))))))))))...))))))..)))))..))).....)))))))))))).((((....((((....)))).....))))..........((((((((...............))))))))..........)))))))..))).........)))))))))).....))))))...)))...)))).))))))))))))..))))))))...((((((((((((((.....((((.....))))((.((((((....))))))))........))))))))))))))..(((((...((((((((((.((((((((((.......))))...))))))......((((((((((.(((((((...)))))))((((((((...))))))))..........(((((((....((((((((......................(((((.((((((((((((.((((...((((((((((..........((........))....(((((((((((.....)))(((((((((((((((((((..(((((((.(((((((.....)))))))...........)))))))..))))))...))).....)))))).)))).......((((((....))))))........(((((((((((((....(((((........)))))..))))))...((((.....))))....((((....((((...((....)).))))))))..(((((((..(((((......))))).)))))))....)))).)))))))))))(((((((((.((.((.(((.((....((((.....)))).......)).))).))))))))))))))))..)))..))))...)))).)))))..........(((.........)))..............)))))))..))))))))))))).......)))))))......((((((((.......((((((....))))))..........)))))))).))))))..)))).(((((((.((((((((.(((...((((((((.....))))))))...((((((((..........))))))))((((...))))(((......)))..((((((((......((((((((((((((......))))))...))))))))))))))))((((((((....))))...))))....)))..))))))))....((((........))))..(((..(((......)))..)))....))))))).))))))))))..))))).....((((((......((((((((...)))))).)).....)))))))))..)))))))...(((....(((.((((....)))).)))....)))......................)))).)))))).((..((.....))..))....))))))))).....)))))))..))))))((((((......))))))))).)).))))....))))))))))..))))....))..))))))))..))).((((((((........)))))))).))))))))........))))....))))))))))))..((.((((((((((....)))).)))))).))..((((...((((.((((...)))).)))).))))((((((((((((.........))))))))))))....(((((((((..((..(((((...(((........)))..)))))..)))))))))))......((((((((...............))))))))..(((((((((....)))))))))))))))))..)).)))).)))..)))).((((((((....................))))))))((((((....((((...((((..((.(((((.........))))).))..)))).))))..))).)))........)))))))))))...))).)).)))))))......)))))).(((.(.(((((.....))))).))))........)))))......))))))))))...))))).)))))))))).....))))..))))))))))))))...)))))))))((((((....))))))..........)))))))).........((((((((((((...(((((...(((..((((((......))))))..)))))))).)))))))))))))))..))))))...)))))).)))))....)).)))))))))....))(((((.((((....)))).)))))......)))).)))))))))))))))))))))...))...)).)))))((((...((((((((((((((..........((((((((.(((((((.......(((((.(((((..((((((((....(((.((((((((((.((((....(((((((......))))).))........))))..)))))).........)))).)))....))))))))...(((......)))...........(((((((((.((.((....)).)).))))..)))))((.((((((.(((.((.....))))).)).)))))).))))).))))))).))))).))))))))..)).))))).))))))))))).....(((((((.((..((.((((.(((((((...........))))))).).)))))..)).)))))))((.((((((.((.....)).)))))).)).....((((((....))))))...)))..)))))).........
Thermodynamic Ensemble Prediction
,.((((({...((,((((((((...{(({(((((.......((((((.((((((.((((({...,(((.(((..,((((({(((((((((((.{,((((((((...((((((..((((.{.(((.(((..,..(((((.....)))))......)))...))).})))).))))))....))))))))....((((((.((..((((.(......).))))..))))))))))))))))))))))))),))),))))}))))))..))))))}))))).,......)))),{(((....))}}))))}.......})))))))||,||,|}||({((({..,(((((.(((((..(((.((((((..........(((.(((((...))))).)))((((((....(((((..((..((((((((.(.((......(((((.(((((((((((({,{.{({.(((((((((......,..(((.......{(((...(((((((((((.,.......,)))).)))))))...)))}......))}.........))))))))).)))}}..{{{((((.((((.((((.((.(((((..((((((({{(((((((.((((....})))((({((..(((((((.{(,..(((((((.,(((({........((((,,,,{{....|||{({{,,,(({,,.,,,,,,,,..|||,|{{{((({,{..(((((((,{{,..,,,,,,,((,,...,,..,,,{,,,,.,,,|}}}}}}.,||{{,....,{{,.((((..((((.........))))..)))).{{,({.......,,,|,..}}}))))),))|,,,.....((({((({,.,{{{{..((((((.....))))))((((((.(((((.....))))).))))))......((,{(((({,(((((......{{(((((((.....))))))).,.}){|||{((......(((.{(((({((((((((((..((((..(((...((((.((.....(((((...((((..(((((.(((((((((((((.,.((((.....))))((((((.((((((((.(.(((((((((.........))))).......((.(((.(((((((((((.,....,(((..{{{{...{((..(((....)))..))}...))})....}}},.(((.(((((..,,(((((..........))))).......,,.(((((...(((((((........)))))))....))))).))))))))})))))))))).))).))..(((((((...(((..((.(((((((...)))))))))..))))))))))))))).)))))},))....)))..))).........((((....)))).))))))))))}........(((,...}}}..((.......||..........||.......)}.}|....))),..,)).)))))..)))),.)))))..))))))....)))..))))....))))))))})).....}))).)}.))),.,}}|}}}}..,..|||{||.,...}})}}},})))))))))))))..(((,.,||,.....))),)))).....}|||,,...,.},}}}.,,..))))),,}))))))}}|,|,.}}},.})))}}|}}},}}}}}}}}),,,,))}}}..(((((((((....)))))))))..)))).....,))))}))))))),,},.)))))))..))).)))..,{(({.,,...}}.}))}......)))))))})}.,))))).))))))).))))))))))))))))))))))))).).))))...)).))))))))}(((((((((,{((((((((((,....}))))}}...})))))}..)))))))))(((.......})).}).)))))....))))))...,,,,....((((({...})))))....,,,,)))))).)))...))))))))))||,..(((((((((((.((.....)).)))))))))))...}))|||}.,..||}.....{(((((...)))))}...,,...{{,((((((((..,.((((((((({{({(((((((..(((,,..,,(((((((.,,{({{...(((((..{((.((((..{(((((.((((((((..(((({,.{,,,{((((((((.{,,,({,({((.{{{,{{|{|{,|,,,....,,}}}|||{{{{((((({{{((({..{((((((..,,{,....{(({{.(((({...})))),.}}})}..|||}}...,,,{||||,.{{{((...{{(({(((..(((((((((({{,,{({({({{.,{(({.......))}|}||{{,,....|,{{{,,......((((((...((((......)))).....)))))).{(((((.((((.....)))).)))))),{{{{,,,,|,,,,{||.{{{{{|,}||,.....}||{}}}}}},))),..,}}},,))}))})..)))))))}..,}}}}}}.,))}}},)}.}))))),..}))}}}}})))|||,|{|,|,,,.||,,,,,{,{.{{{{,||||||||{||..||||.}}},))}}||||}}|,,,.}}}}}}}}}}}}},..(((((.....)))))((((((((....)))))))).{{,{{{{,((((((((({.....{({..(((((({.(((((((({...((((....))))...((((((((..(((({{(((.(((((((((((........((((((....)))))).)))).))))))).))))))))..))).)))))......))))))))).....(((((((((({.....{{{,,(((((,((....})).)))))..|||,,,{((((...((((..|.||,.....,}}},,,,}....,,}}|}|||,........{{{{...,,,.))))........(((((({((({...}})}).)))))).........(((((((((((.(((((((((((.{({(((((((((.((((.(({{{{(((({{((({(((({{{..,,{{,,,,,))}),|,{{{,{{{{{{..{{{{{.{{{{{{{,||||||||,,,,,|{(({(((((((((.((.....((((((((((.......))))...)))))).,({{{(((((......(((((((...)))))))((((((((,,.}})))))),..,,...)))))))}}..)}.)))}}})})}.{,.(((((,...{(({..((((,.,.{({{,,{((,{((((..,..(((((.,,.......))}}|..,..}}}},..,,|,,,.||...}|}}.||||,...))))}.,|,((((((..(((((((,(((((((.....)))))))...........,))))))..))))))..,||||..,{{{{(({,{|{((({{{,.,,{(({....})|}}},}}|||,...,,||(((((((....(((((........)))))..)))))),..{{{{.....)}}).,}}|,}}}}},,.{{{{|{{..{,|||||||,,},..{{{{{{{..|||||.,,,,,))))}.}}}}}}}....{{{{{{(((|{,((({(((((((({{((,{,.{{(,{{....{{{{.,,,,}}}},.....,)).}}},}}}}))))))))){{{...))}..|{.{((((.....))))}........)))}}}||||..|||{{{{{{{{{{{{,,,,{{{|{{{{{,,,{{{{||||{{{{({,{((({{(.{{(,.,,,,..|},,..,})))},}|}|.,|||}}}}||||....{{{{{{{.,{||,,{{....}).,))}..}}}}}}|{((((({{,.((((((((.....))))))))...|{{{||||,,,.|||.,{||}||}},,,,,.,,)))}{||,.....)))..((((((((......((((((((((((((......))))))...))))))))))))))))..,{{{||....))))}..||}}}|,||,,.,,{{|((.|{{{|||},...,|{{{{|{...{((,,{((......)}}..}}}.,,|||}}}}),}}))))))),,|||||||{{{{(,({{{,,....({((((((...)))))).)}.....((((.(((((((.(((((({.(((....(((.((((....)))).)))....)))............,,,,........,,.,....,.{,..{{..,|,)){{{,.,...{((((.........}}}}},,,.|},..((((((......))))))...)))))))))))))).)))).....,,{{{...(((((((({.....})}}|))))}||,,,....,)))))}))}||..,,,},...}}}}},,|})|||..|})}),},.,|}}}||||{|||||,..,))))}))),,,....{{{{,,..,((({(({(,{{{{||.{{|,..,{{((((((((((((.,.......))))))))))))}...(((((((((,.,{..(((((...{{(,,.....,))}..)))))..})))))))))).,{{{{,,,|||||,...,..{{{{..,,||||||||..{((((((({....})))))))}((((,,.{{....,}),.))))}..{{|(((((({,....}}}}}},},...,,}}},))))))}},}||))))|}}})).||||..{{.{{{{|....,,{|{||||,.,,}})))),}}|{,,{,...,((,,,,..,,.,},)))},,.....}}}},..}|||||||,,,,..,)))))),},|{{||,,,.,))))).)))))),,,..}}}}.}})))))))..)}))))}...))))),,}})))}}})))))}}}}}|,||||}|,|||,}}}}}}}}}}}}}}||||||},,.}}},,,,.((((((((((((..{{,{,......((((((((((((...(((((...(((..((((((......))))))..)))))))).)))))))))))).,,..)},,......((((((,{{....}))))))).))))))))))))..{({,((((((((({....,{(({......}}||...(((.,,.....(((((..((((.((,.((((,.({(.....}}},),..}))).,.)).)))).)))))......}})))..,,,..,}.)))))))))}})},,|}}}}.))))))))..(((((......))))).((((((((.{{,{(((((......)).)))}....))...))))))))))).))))))))))}.}))))))))))))))))),,}}.))))))))))((({({,(((.((......))})),.)))))|(({(.,..})}}||||,,,,,||||}.,},}},}||{|{{{..,,,,.,))),}))))))))....))),,)))).)))....)))))))))))))))..))))})))))))(((((((.........,.)))))))...,........},.}},..)))..))))))).}}}{||.,,))}..,,,,...,.}})))))))),,.)))))))).)))))),,.......

Transcripts

ID Sequence Length GC content
GUCUGCGCCCUGGUGCCAGGCGCUCAGCUCGGCGCUCCCCUGUGCUCGC… 5727 nt 0.4212
Summary

This gene encodes a coiled-coil domain-containing protein. The encoded protein is ubiquitously expressed and may function as a tumor suppressor. A chromosomal rearrangement resulting in the expression of a fusion gene containing a portion of this gene and the intracellular kinase-encoding domain of the ret proto-oncogene is the cause of thyroid papillary carcinoma.[provided by RefSeq, Sep 2010]

Forensic Context

A study in mice demonstrated that chronic alcohol exposure increases HDAC levels, leading to H4 hypoacetylation and inhibition of gene expression in the nucleus accumbens [Hediyal et al. DOI:10.3390/Brainsci15090927]. Research in rats and mice shows that acute or repeated exposure to cocaine or other stimulants increases global levels of histone H4 acetylation in the nucleus accumbens, a modification associated with gene activation [Nestler DOI:10.1016/J.Neuropharm.2013.04.004].