Basic Information

Symbol
ACTB
RNA class
mRNA
Alias
Actin Beta Actin, Cytoplasmic 1 PS1TP5-Binding Protein 1 Beta Cytoskeletal Actin I(2)-Actin Beta-Actin EC 3.6.4.- PS1TP5BP1 Β-Actin BKRNS BRWS1 CSMH DDS1 THC8 BNS
Location (GRCh38)
7:5526409-5563902
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Time since deposition estimation Tissue/body fluid identification Individual identification Postmortem interval inference
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001101.5
Sequence length
1812.0 nt
GC content
0.5519

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-613.01 kcal/mol
Thermodynamic ensemble
Free energy: -643.97 kcal/mol
Frequency: 0.0000
Diversity: 373.51
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.(((...)))))....))).((((...((.((((((((((((.(((((((((.((((((((..((((((.(((((((((((.(((((((...((((...(((....)))...))))...((((((((((.(((.((.(((((((..((((..((((...))))))))..((((........)))).......(((.(..(((.((...((.((((.(.((((((.(((((.(((...(((((......))))).........))).)))))....................(((((((..(((((.((....)))))))...(((.....))).....((((((..((......))..).)))))(((((...)))))...))))))).)))))).).)))).))...)))))..))))..)))))))((.((((......)))).))(((.....))).....)).))).)))))).))))....((((.((((.......))))))))((((((((......(((((.(((.(((((((((....))))))...)))))).))))).......(((((.....)))))......(((((((((((((.((.(((((....))))).)).)))(((.....))).((((.(((....(((.((.(((.((((((((.((..((((..(((........)))..)))).......)).))))))))))).)))))....)))))))..)).)).))))))((.(((.((((..((((((((....)))..)))))..)))).))))))))))))))))))))))).)))...)))))(((((((.(((((.(((((.........))))).......)))))))))).))(((((..((((((..((...(((((.........))))).))..))))))...))))).((((..((((.........)))).)))))))))).......((((.((((..........)))).))))...((((...(((((.((((...))))...(((((.........)))))((((.....)))))).))).)))))))))))).))))))....(((((..((.(((((((((..((.....)).))))).)))).))))))).......(((((.((((....(((.((((.((.............)).)))).)))......((((((............................))))))((((((((((((((..((((..........))))..))))))))))))))..................)))).)))))..............))).))))))))))))..))(((((((....(((((((((...((((((((.............)))))))).......(((((((......)))))))(((.......))).))))).))))((((((((((((.(((((.(((....(.((((((((.((((((....)))))).((((..(((.((((((..((....))..)))))).))).(((((((...............)))))))............(((((((...(((.((...........)).)))...)))).)))((((((((((((....................................))))))))))))..))))....)))).)))).)))))))))...)))))).)))))).)))))))...................))))...............
Thermodynamic Ensemble Prediction
..{{{,{.{,,{{{|,,||,..,))).(({(...{{.((((((((((((.(((((((((.((((((((..((((((.(((((((((((.(((((((...((((.,.(((....)))...))))...((((((((((.(((.((.,{{({(({{{{{{..{({{...|||}||||.,((((......,.)))},{{{...|||.{..(((.((...((.((((.{.((((((.(((((.(((.{.(((((......))))).,.......})).))))),....,,..,.....,.,,,(((((((..(((((.((....)))))))..,{{(.....})),....((((((.,(,.....,))..).)))))|((((...))))}...))))))).)))))).}.)))).)}...)))))..})))..})))))}||||||,..,...}}}|{||{((,...,)))},,..}}.))).)))))),,))}....((((.((((.......))))))))((((((((......(((((.(((.{((((((((....)))))),..})}))).))))).......(((((.....)))))......(((((((((((((.((.(((((....))))).)).))),{{.....}},,((((.(((....(({,((.(((.((((((((.((..((((.,(({........))),,)))).......)).))))))))))).)))))....))))))),.)),,).))))))({.(((.((((..((((({((....}}),.)))))..)))).)))}})))))))))))))))))),}))...)))))(((((((.(((((.(((((.........)))),.......)))))))))).))(((((..((((((..((.{,(((((.........))))).))..))))))...))))).{(((..((((.........)))).)))))))))).......((((.((((,{...,,,,.}))).)))),..((((...({(({.((((...))))..,{{{{{.........))}}}((((.....)))))},.}}.)))))))))))).)))))),,,.(((((..,(.(((((((((..({.....)).))))).)))).})))))).......(((((.((((....(((.((((.((,,....,,.....)).)))).)))......{(((((..................,.........)))))}((((((((((((((..((((..........))))..))))))))))))))..................)))).))))).|............))).))))))))))))..}},{{{{|{|{,,({({((({{...,{{({{{{,{,,,{{{..,|,}},}})))...,}|||||||{{......,}}}},|({{.......})),))))).}}|}{(((((((({((,(((((.{((....,.((((((((,((((({....||}||,.{{{(..(((.((((((..((....))..)))))).))).(((((((.....,.........)))))))............(((((({...(((.((...........)).}))...)))).)))((((((((((((...................{,..........),),.))))))))))))..)))),,},)))),)))),)))))))))..,)))))).))))))}}}||}}|.,....,},},........))))...............

Transcripts

ID Sequence Length GC content
NM_001101.5 NCBI
ACCGCCGAGACCGCGUCCGCCCCGCGAGCACAGAGCCUCGCCUUUGCCG… 1812 nt 0.5519
Summary

This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling. The encoded protein is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins that are ubiquitously expressed. Mutations in this gene cause Baraitser-Winter syndrome 1, which is characterized by intellectual disability with a distinctive facial appearance in human patients. Numerous pseudogenes of this gene have been identified throughout the human genome. [provided by RefSeq, Aug 2017] CIViC Summary for ACTB Gene

Forensic Context

A study in human bloodstains demonstrated that the ACTB gene's RNA degradation ratios, specifically 578:51, 998:51, and 1782:51 bp fragment ratios, correlate well with the time since deposition for up to 6 months at room temperature, with the 578:51 ratio suitable for up to 6 months (R²=0.9585), the 998:51 for up to 2 months (R²=0.9151), and the 1782:51 for up to 1 month (R²=0.8653) [Nakanishi et al. DOI:10.1016/j.forsciint.2025.112708]. Another study in human forensic samples established the ACTB mRNA as a suitable reference marker for qPCR normalization due to its similarly high expression in skin and all tested body fluids, enabling sensitive detection from minute skin samples like thumbprints and showing stable expression after 6.5 months of storage [Visser et al. DOI:10.1007/s00414-010-0545-2]. A study in rats demonstrated that the ACTB mRNA, specifically the DCt value for b-actin, showed the highest correlation with postmortem interval (PMI) across multiple temperatures and was used to build a validated mathematical model for PMI estimation [Ma et al. DOI:10.1007/S12024-015-9703-7]. Research in pigs showed that differential degradation rates between a large (301 bp) and a small (71 bp) segment of porcine b-actin mRNA in tooth pulp could be used to estimate PMI for up to 84 days postmortem [Young et al. DOI:10.1016/J.Forsciint.2013.03.035].