Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGAGGCUGAGACCAACCCAGAAACCACCACCUCUCACGCCAAAGCUC… | 1005 nt | 0.4418 |
Summary
This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity for eosinophils, but not mononuclear cells or neutrophils. This eosinophil-specific chemokine is thought to be involved in eosinophilic inflammatory diseases such as atopic dermatitis, allergic rhinitis, asthma and parasitic infections. [provided by RefSeq, Sep 2014]
Forensic Context
A study in humans using integrative machine learning on monozygotic twin pairs identified the CCL11 as a cytokine with higher levels in heavier twins who had lower HDL cholesterol, linking it to obesity-associated dyslipidemia [Kibble et al. DOI:10.1098/rsos.200872]. In rats, RNA sequencing of cardiac fibroblasts across developmental ages showed the CCL11 was core-enriched in downregulated immune-associated datasets in fetal versus neonatal cells and was upregulated in adult cells compared to both neonatal and fetal groups, indicating age-dependent expression shifts in cardiac immune function [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021].