Basic Information

Symbol
CCL17
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 17 TARC ABCD-2 SCYA17 Small Inducible Cytokine Subfamily A (Cys-Cys), Member 17 Thymus And Activation-Regulated Chemokine Chemokine (C-C Motif) Ligand 17 Small-Inducible Cytokine A17 C-C Motif Chemokine 17 CC Chemokine TARC T Cell-Directed CC Chemokine A-152E5.3
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002987.3
Sequence length
616.0 nt
GC content
0.5795

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-234.50 kcal/mol
Thermodynamic ensemble
Free energy: -245.45 kcal/mol
Frequency: 0.0000
Diversity: 168.53
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((........))))))))...(((.(((.((..(((((.(.(((((((((..............))).))))))).))))).)))))))).....(((((((.....((((((((.((((.(((((((.(((.(..((((.((((((((((((..(((((....)))))..((((.((.((........)).))..)))))))))....)))))))((..(((.(((((((((......((((....))))(((((((...(((............)))...)))))))..))))))))).).))..))((((((.(...(((.(..((.((((((.(((.((.((((((........(((.(((......(((((........)))))......((((((((......)))).))))...(((....)))))).)))((((((....))))))............((((((((..(......)..)))))))).)))))))).)))))))))))..).))).).))))))......(((((.(((...))))))))))))..).))).))))))))).))..)))))))).....))))))).......
Thermodynamic Ensemble Prediction
((((((((........))))))))...(((.(((.((..(((((.(.(((((({((..............))).))))))).))))).)))))))).....(((((((.....((((((((.((((.(((((((.(((.,..({({,,({{((((((,,..(((((.{{{({|{((,,{,,,||{{{,,,((((.((.((((,{{({..,..{{.||||}{(((({(((.((({(({...}}},}||,}},,}))))),|{,{,..,|||{{{({{{{{{,,|.,...||||,||,..,})))}}))}})))}.}}}}}}|{{,...,}}}}|((|{({|,,.}))}}}}((((.{{{{{.....{{{.{{......(((((........)))))......((((((((......))))}}))}...,(({(........)))|((((((....))))))}.}}}....}}}||,||||,..}}}}.}})}}))))))),}))))}}}))))))),,,,)))))).}......,.}},.||||(((((.(({...}))))))))})),.,.))).))))))))).))..)))))))).....))))))).......

Transcripts

ID Sequence Length GC content
GCUCAGAGAGAAGUGACUUUGAGCUCACAGUGUCACCGCCUGCUGAUGG… 616 nt 0.5795
Summary

This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for T lymphocytes, but not monocytes or granulocytes. The product of this gene binds to chemokine receptors CCR4 and CCR8. This chemokine plays important roles in T cell development in thymus as well as in trafficking and activation of mature T cells. [provided by RefSeq, Sep 2014]

Forensic Context

A study in mice demonstrated that the CCL17 was specifically induced in the late lethal stage of *E. coli*-induced sepsis, identifying it as a potential marker for acute sepsis [Zhang et al. DOI:10.1093/jimmun/vkaf140].