| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCAGAGAGAAGUGACUUUGAGCUCACAGUGUCACCGCCUGCUGAUGG… | 616 nt | 0.5795 |
This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for T lymphocytes, but not monocytes or granulocytes. The product of this gene binds to chemokine receptors CCR4 and CCR8. This chemokine plays important roles in T cell development in thymus as well as in trafficking and activation of mature T cells. [provided by RefSeq, Sep 2014]
A study in mice demonstrated that the CCL17 was specifically induced in the late lethal stage of *E. coli*-induced sepsis, identifying it as a potential marker for acute sepsis [Zhang et al. DOI:10.1093/jimmun/vkaf140].