| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGGAGGCCAGGAGUUGUGAGUUUCCAAGCCCCAGCUCACUCUGACC… | 1332 nt | 0.4429 |
This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for naive T cells, CD4+ and CD8+ T cells and nonactivated lymphocytes, but not for monocytes or granulocytes. This chemokine attracts naive T lymphocytes toward dendritic cells and activated macrophages in lymph nodes. It may play a role in both humoral and cell-mediated immunity responses. [provided by RefSeq, Sep 2014]
A study in humans demonstrated that the CCL18 is a spatially variable gene predominantly expressed in specific cell types within the corpus cavernosum tissue, serving as a marker of spatial specificity [Yin et al. DOI:10.1016/j.celrep.2024.114760]. In a separate human study of BMI-discordant monozygotic twins, the CCL18 was found to be upregulated in the subcutaneous adipose tissue of heavier co-twins and is associated with immune and inflammatory responses [Muniandy et al. DOI:10.1038/ijo.2017.95].