Basic Information

Symbol
CCL18
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 18 DC-CK1 AMAC-1 DCCK1 MIP-4 PARC SCYA18 CKb7 Small Inducible Cytokine Subfamily A (Cys-Cys), Member 18, Pulmonary And Activation-Regulated Chemokine (C-C Motif) Ligand 18 (Pulmonary And Activation-Regulated) Alternative Macrophage Activation-Associated CC Chemokine 1 Pulmonary And Activation-Regulated Chemokine Macrophage Inflammatory Protein 4 Dendritic Cell Chemokine 1 C-C Motif Chemokine 18 CC Chemokine PARC AMAC1 Pulmonary And Activation-Regulated Chemokine (C-C Motif) Ligand 18 Small Inducible Cytokine A18 Small-Inducible Cytokine A18 Chemokine (C-C), Dendritic CC Chemokine Ligand 18 MIP4
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002988.4
Sequence length
1332.0 nt
GC content
0.4429

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-390.10 kcal/mol
Thermodynamic ensemble
Free energy: -418.73 kcal/mol
Frequency: 0.0000
Diversity: 304.86
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((.(((..((((........))))..))))).(((.((((((.((((((.......(((.(((...((.((.(((((.((((((................).)))))....)))))))))...))).)))...((((....))))....(((((((..(((((((((...((((((((.....(((((..((((((((...((....((((.....((((..((((.(((((.(((((((((((..((((((.....)).))))..))))..)))).)))((((((........).)))))(((..((...(((((........)))))))..))).)))))))))..))))..))))..)))))))))).))))).))))))))(((.((((((((...((((((...((((...))))))))))))))).))).))).....((((((((((((.(((((.....(((.((((((........)))))).)))..(((((((((........(((((((((((.(((......))).)).))))))))).........((((((....))...))))(((((..(((((((((..((((.((((.....(((((((...(((((.(((......((((((.....(((.....)))..))))))(((((..(((........)))......(((((((.(((..(((...)))..))).)))))))...))))).(((((..........)))))..)))))))).....))).)))).(((((.(((((((..........)))))))))))).)))).))))....)))))))))))))))))))))))....))))).....))).)))).)))))...(((....)))((((((.((((........))))........((((.((((((.((......(((..((((((.((((......))))))))))...))).((((((...)))))).......(((((..(((((((((......(((........)))...((((((((((....))))).))))).((((((...((((.....))))..))))))..(((((((((((((((((.(((((..((((.((...((((.......)))).)).))))))))).)))))))))..((((((......)).))))(((...))))))))))))))))))))))))).....)).)))))).))))(((.....))))))))).....))))))))).))))))))))))).)))))).))).........................
Thermodynamic Ensemble Prediction
....((.(((..((((........))))..))))).(((.((((((.(((({,..,{{{.,((,({{{,.,,.|.,(((((.{({{(,,{..,.....|.....}.}}))}....)))))}}||{,.},}.))}...((((....))))....((({{{{..(((((((((...((((((((,.,..,{{{{..{(((((({...||.|,..|||,....((((..((((.(((((.(((((((((((..((((((.....)).))))..)))}.,)))).)))((((((........).)))))(((..,,...(((((........)))))}),.))).)))))))))..)))).,.|||{,{{,|}}}}}},})))))))))))))(((.((((((((...((((((...((((...))))))))))))))).))).)))...{.((((((((((((.(((((.....(((.((((((........)))))).)))..((({(((((.....|||((((((((({{.(((......))).}}.))))))))}...,,,...((((,,....}}...)))).,,.,..{(((((({(,,(((({(,,,.,,,,({((.((((..((((((((..{{,,{{((((,....({,.....}}),.)))))).,}}},,}))))..})))}}...,,..,,,,||,,(({,.{((...)))..|((((((||(({{.{({.....,||,.}))))))))))),..}|||,|||,,,,.|||}},}}.((((,{(((((((.,.....,,.)))))))))))).}))),)))}....))))))))))})))))))}))))....))))).....))),,))).))))),..{{,....}}}((((((...(({{,,,,,,||(((({.,.|||||{.((((((.((.....,(({..(((({{{((((......))))))))))..,))).((((({...}))))).......(((((..(((((((({......{{{........))}...((((((((((....)))))},)))).((((({...((((.....))))..))))))..(((((((({((((((({.(((((..((((.({...{(((.......)))).,,.))))))))).}}))))))}..((((((......))},))){{|...))))))))))),))))))))))))).....)).)))))),))))}}}))))}.,,)))))).....))))))))).})))))))))))).)))))).))).........................

Transcripts

ID Sequence Length GC content
AGAAGGAGGCCAGGAGUUGUGAGUUUCCAAGCCCCAGCUCACUCUGACC… 1332 nt 0.4429
Summary

This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for naive T cells, CD4+ and CD8+ T cells and nonactivated lymphocytes, but not for monocytes or granulocytes. This chemokine attracts naive T lymphocytes toward dendritic cells and activated macrophages in lymph nodes. It may play a role in both humoral and cell-mediated immunity responses. [provided by RefSeq, Sep 2014]

Forensic Context

A study in humans demonstrated that the CCL18 is a spatially variable gene predominantly expressed in specific cell types within the corpus cavernosum tissue, serving as a marker of spatial specificity [Yin et al. DOI:10.1016/j.celrep.2024.114760]. In a separate human study of BMI-discordant monozygotic twins, the CCL18 was found to be upregulated in the subcutaneous adipose tissue of heavier co-twins and is associated with immune and inflammatory responses [Muniandy et al. DOI:10.1038/ijo.2017.95].