| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCCCAGCCUCACAUCACUCACACCUUGCAUUUCACCCCUGCAUCCCA… | 683 nt | 0.5769 |
This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene may play a role in normal lymphocyte recirculation and homing. It also plays an important role in trafficking of T cells in thymus, and in T cell and B cell migration to secondary lymphoid organs. It specifically binds to chemokine receptor CCR7. [provided by RefSeq, Sep 2014]
A study in mice demonstrated that during gingival wound healing, the chemokine CCL19 gene expression was up-regulated at 24-48 hours post-wounding, suggesting a role in promoting the entry of beneficial mononuclear cells during tissue repair [McGrory et al. DOI:10.1016/j.bbrc.2004.09.056]. A study in rats demonstrated that blast wave exposure induced time- and intensity-dependent changes in mRNA expression for vascular wound healing and inflammatory markers, where the CCL19 showed a transient up-regulation at 24 hours after a 10–11 psi overpressure exposure but an opposite polarity response at 2 hours after a more severe 14–15 psi exposure [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].