Basic Information

Symbol
CCL19
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 19 ELC CK Beta-11 Exodus-3 MIP-3b SCYA19 CKb11 Small Inducible Cytokine Subfamily A (Cys-Cys), Member 19 Epstein-Barr Virus-Induced Molecule 1 Ligand Chemokine Macrophage Inflammatory Protein 3-Beta Chemokine (C-C Motif) Ligand 19 Small-Inducible Cytokine A19 Beta Chemokine Exodus-3 CC Chemokine Ligand 19 C-C Motif Chemokine 19 EBI1-Ligand Chemokine MIP-3-Beta MIP3B Macrophage Inflammatory Protein 3 Beta Beta-Chemokine Exodus-3 EBI1 Ligand Chemokine
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_006274.3
Sequence length
683.0 nt
GC content
0.5769

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-236.40 kcal/mol
Thermodynamic ensemble
Free energy: -248.75 kcal/mol
Frequency: 0.0000
Diversity: 207.76
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....................(((((..((..........((((((.((.(((((((...((.((((((..((.((((((((((((.(((((..((((((.((.........)).)))..))).))))).......((.(((((((...((((((((...(((.(((((((((.((..(((((((((((((....)).).)))....((((((((...(((((((.(((.((((.....)))).(((((....))))).(((((((((((............)))))))....)))).(((((.(((..(((((((.((((((((....((((((..((..(((((((((((...(((((.......)))))......))).....))))).)))....)).))))))....).)).))))).)))))))..........))).)))))))).))).(((...))))))).))))))))................)))))))))))))))))).))).)))..((((((....((......))...)).))))....)))))..))))))))))))))))))).)).))..))))))))...))))))).)).(((..(((((....))))).)))....)).))))..(((........))).))..)))))..........
Thermodynamic Ensemble Prediction
.....{{.{{((...{{.(((((({{((((({,,(((...,(((((((((,((((((((((((,,,,.,.,{({((,{{{.,,,,({(((((.,((((,((,,.{,..,,.{{{{((..{{||.,,,.........,,.((((,,,...,,||||(((((,,.,,(((,,,,({((...,,,||}|,.}|}.,.})))).)))}}}}}}||||,|}..||,|}}}},|}}}}}|{|((((((..........)))))).},..||||({|..........,,||}},,,.,}))},))}}}}}}|||}.(((((((.(((((((.....((((((..((..(((((((((((...(((((.......)))))..,...))).....))))).)))..,.)}.))))))....}.))}}}))).)))))))..........,,.({(({{{||{{{{..(({{,{||.{|{..,|,|||{{,....,,,,....{{||||,,.)),))),||},.,})..,)})|.)}})))..))))))))))}}..,.((((.{{...,,)).))))},)))))))))),))))))))))))))))),}}}))),)),|||{((,,,({{{,...,))}}),}},.{{{{...((...(((........))).)))))),}...........

Transcripts

ID Sequence Length GC content
AUUCCCAGCCUCACAUCACUCACACCUUGCAUUUCACCCCUGCAUCCCA… 683 nt 0.5769
Summary

This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene may play a role in normal lymphocyte recirculation and homing. It also plays an important role in trafficking of T cells in thymus, and in T cell and B cell migration to secondary lymphoid organs. It specifically binds to chemokine receptor CCR7. [provided by RefSeq, Sep 2014]

Forensic Context

A study in mice demonstrated that during gingival wound healing, the chemokine CCL19 gene expression was up-regulated at 24-48 hours post-wounding, suggesting a role in promoting the entry of beneficial mononuclear cells during tissue repair [McGrory et al. DOI:10.1016/j.bbrc.2004.09.056]. A study in rats demonstrated that blast wave exposure induced time- and intensity-dependent changes in mRNA expression for vascular wound healing and inflammatory markers, where the CCL19 showed a transient up-regulation at 24 hours after a 10–11 psi overpressure exposure but an opposite polarity response at 2 hours after a more severe 14–15 psi exposure [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].