| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGAGGCUGAGACUAACCCAGAAACAUCCAAUUCUCAAACUGAAGCUCG… | 741 nt | 0.4103 |
This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and basophils but not for neutrophils or eosinophils. It has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, like psoriasis, rheumatoid arthritis and atherosclerosis. It binds to chemokine receptors CCR2 and CCR4. Elevated expression of the encoded protein is associated with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection. [provided by RefSeq, Aug 2020]
A study in human patients with posttraumatic cerebral contusions demonstrated that the CCL2 was the most consistently and strongly expressed chemokine in pericontusional brain tissue, with mRNA levels elevated as early as 3.5 hours after trauma and showing a biphasic peak pattern [Stefini et al. DOI:10.3171/JNS/2008/108/5/0958]. In a separate study investigating UVB-induced inflammatory pain, the CCL2 was significantly up-regulated in rat dorsal root ganglia, and its expression was validated by qPCR, implicating it in pain processing [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a separate rat model of acute right heart failure, the CCL2 was identified as a protein with more interactive evidence in the right ventricle protein-protein interaction network compared to the left ventricle [Cao et al. DOI:10.1177/2045894019879396].