| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAUAUAACAGCACUCCCAAAGAACUGGGUACUCAACACUGAGCAGAU… | 831 nt | 0.3550 | |
| AGAAUAUAACAGCACUCCCAAAGAACUGGGUACUCAACACUGAGCAGAU… | 834 nt | 0.3561 |
This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene displays chemotactic activity for lymphocytes and can repress proliferation of myeloid progenitors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
A study in mice demonstrated that the CCL20 gene expression was up-regulated at 24-48 hours post-gingival wounding, suggesting a role in promoting the entry of beneficial mononuclear cells during tissue repair [McGrory et al. DOI:10.1016/j.bbrc.2004.09.056]. Furthermore, genome-wide transcriptional profiling in human and rat skin showed the CCL20 was significantly up-regulated at the peak of UVB-induced inflammatory hyperalgesia, with a fold change of 57.0 in human and 44.3 in rat skin, highlighting its potential as a pain mediator [Dawes et al. DOI:10.1371/journal.pone.0093338].