Basic Information

Symbol
CCL21
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 21 6Ckine SLC SCYA21 TCA4 CKb9 ECL Small Inducible Cytokine Subfamily A (Cys-Cys), Member 21 Efficient Chemoattractant For Lymphocytes Secondary Lymphoid Tissue Chemokine Chemokine (C-C Motif) Ligand 21 Beta Chemokine Exodus-2 C-C Motif Chemokine 21 Exodus-2 Secondary Lymphoid-Tissue Chemokine Small-Inducible Cytokine A21 Beta-Chemokine Exodus-2
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Wound age identification

MANE select

Transcript ID
NM_002989.4
Sequence length
864.0 nt
GC content
0.5810

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-303.80 kcal/mol
Thermodynamic ensemble
Free energy: -317.14 kcal/mol
Frequency: 0.0000
Diversity: 205.87
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.................((((((............(((((.((((..........(((((((.(((......(((((((.........))))))).((((.((((((.....(((...)))....))))))...))))..))).))))))).....((.((((.((.....))))))))...(((....))).)))).)))))...))))))...(((((..(((((..(((((.(((((((((((((((((...(((((((((.((..(((...(((((.....)))))....))).........(.((((((((((((.(((.....))).)).((((..................)))).....)))))))))).).)))))))))))((((.((((....((........))...(((((((((..((((((..........((.((((...)))).))...((((....)))).....))))))))))))))))))).))))...((((((....(((((((...........)))).)))......))))))..)))..))))...))))))))))....((((((..(((((....(((((((((((((((((....(((...(((((.....((((((..((......))..))))))......)))))...)))....)))).)..))))))))))))....))))))))))).((((.(((((.....))))).))))...((((....((((((........))))))....))))......................(((((((...)))))))..............))))))))))..))))).......
Thermodynamic Ensemble Prediction
...............,.((((((............{((({.((((.,,,......(((((((.(((......(((((((.........))))))).((((.((((((.....(((...)))....))))))...))))..))).))))))),...,((.((({{((.....}}})))}}...(({....}}).))}}.))))),..))))))...((((({,(((((..{((((.(((((((((({((((((,,.(((,((((({(...,(({{{(((,{.,{{{,|}}|,.,.|||{{.{({...({,(((((((((((.(((.....))).))}|||||.................,,},.....)))),)))))))}|},})|,},||((((.((((....((........}}...((((((((,.,((((((..,.,,.{{,,,.{{{{.,,)})).))...((((....)))).....))))))))))))))))))).)))).}},||||,...}|||||||....,,.....}}}).,))}}),,.})))}),.)))..))))...))))))))))....((((((..(((((....(((((((((((((((((....(((...(((((.....((((((..((......))..))))))......)))))...)))....)))).),.))))))))))))....))))))))))).|((({((,{{..{{.,||{,.,||,{..((((....((((((........))))))....)))).}}}.,},..}}..)}))})}}|{{{{{{...}}})}},.......,......})))))))))}.))))).......

Transcripts

ID Sequence Length GC content
ACAGACCCCCAACUUGCAGCUGCCCACCUCACCCUCAGCUCUGGCCUCU… 864 nt 0.5810
Summary

This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). [provided by RefSeq, Sep 2014]

Forensic Context

A study in human ischemic cardiomyopathy (ICM) patients demonstrated that the CCL21 is a marker for lymphatic endothelial cells (EC-lymphatic) and its expression was validated by in situ hybridization, showing increased expression in fibrotic regions of ICM tissue [Simonson et al. DOI:10.1016/j.celrep.2023.112086]. A separate study in human skin wound healing identified the CCL21 as a chemokine marker expressed in endothelial cell clusters within the wound microenvironment [Liu et al. DOI:10.1016/j.stem.2024.11.013].