| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGACCCCCAACUUGCAGCUGCCCACCUCACCCUCAGCUCUGGCCUCU… | 864 nt | 0.5810 |
This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). [provided by RefSeq, Sep 2014]
A study in human ischemic cardiomyopathy (ICM) patients demonstrated that the CCL21 is a marker for lymphatic endothelial cells (EC-lymphatic) and its expression was validated by in situ hybridization, showing increased expression in fibrotic regions of ICM tissue [Simonson et al. DOI:10.1016/j.celrep.2023.112086]. A separate study in human skin wound healing identified the CCL21 as a chemokine marker expressed in endothelial cell clusters within the wound microenvironment [Liu et al. DOI:10.1016/j.stem.2024.11.013].