| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGGAAGAGUCUAGGCUGAGCAACAUGAAGGGGCCCCCAACCUUCUGCA… | 417 nt | 0.5348 |
This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene is chemotactic for skin-associated memory T lymphocytes. This cytokine may also play a role in mediating homing of lymphocytes to cutaneous sites. It specifically binds to chemokine receptor 10 (CCR10). Studies of a similar murine protein indicate that these protein-receptor interactions have a pivotal role in T cell-mediated skin inflammation. [provided by RefSeq, Sep 2014]
A study in humans demonstrated that the biomarker CCL27 is a highly specific and sensitive mRNA marker for skin identification in trace biological evidence, with no cross-reactivity observed with other body fluids and detection down to 5 pg of input total skin RNA [Hanson et al. DOI:10.1016/j.fsigen.2012.01.004]. Further research in humans identified the biomarker as expressed in Spi-III keratinocyte subtypes during wound healing, contributing to the cellular dynamics of skin repair [Liu et al. DOI:10.1016/j.stem.2024.11.013].