Basic Information

Symbol
CCL27
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 27 Skinkine ESkine CTACK ILC CC Chemokine ILC SCYA27 PESKY CTAK ALP Small Inducible Cytokine Subfamily A (Cys-Cys), Member 27 Cutaneous T-Cell Attracting Chemokine Chemokine (C-C Motif) Ligand 27 IL-11 R-Alpha-Locus Chemokine IL-11 Ralpha-Locus Chemokine Small-Inducible Cytokine A27 C-C Motif Chemokine 27 Cutaneous T-Cell-Attracting Chemokine
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Wound age identification

MANE select

Transcript ID
NM_006664.4
Sequence length
417.0 nt
GC content
0.5348

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-131.80 kcal/mol
Thermodynamic ensemble
Free energy: -139.11 kcal/mol
Frequency: 0.0000
Diversity: 130.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((.(((.(((((.((((...((((((((..((((((.((((((((((.....(((((((((........(((....))).....))))))))).......(((......)))......((((....))))((((((((..(((..((((((........))))))..)))..))..)))))).)))))))))).))..)))).(((.......))).)))))))).))))))))))))...((((...)))).)))...(((((((...((((.((.......(((..(((..(((.(.(((....)))).)))..))).))))).))))..)))))))(((((.(((((...((((....))))(((((.((..............))))))).......))))).)))))..
Thermodynamic Ensemble Prediction
..((,.(,((((,(({((((((,,,,(((((,,.......)))}}.(((((....,||}||,{|...}}}}}...}}}}.)))}.,|{{{(((({{......,{({....,|)|}.}},,)))))}|,,|{{.(((((({,..(((..((((((........))))))..)))..,}..)))))}.,}||||{||{,{{{{({,,.}}}}}}})))).|||},,,}})}}}}}}})))}}}...((((...)))).}}}...(((((((...((((.((....,,.(((..(((..(((.(.(((....)))).)))..))).))))).))))..))))))){{(({.,(({,...((((....))))(((((.((..............))))))).......,}))),))))}..

Transcripts

ID Sequence Length GC content
AAGGAAGAGUCUAGGCUGAGCAACAUGAAGGGGCCCCCAACCUUCUGCA… 417 nt 0.5348
Summary

This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene is chemotactic for skin-associated memory T lymphocytes. This cytokine may also play a role in mediating homing of lymphocytes to cutaneous sites. It specifically binds to chemokine receptor 10 (CCR10). Studies of a similar murine protein indicate that these protein-receptor interactions have a pivotal role in T cell-mediated skin inflammation. [provided by RefSeq, Sep 2014]

Forensic Context

A study in humans demonstrated that the biomarker CCL27 is a highly specific and sensitive mRNA marker for skin identification in trace biological evidence, with no cross-reactivity observed with other body fluids and detection down to 5 pg of input total skin RNA [Hanson et al. DOI:10.1016/j.fsigen.2012.01.004]. Further research in humans identified the biomarker as expressed in Spi-III keratinocyte subtypes during wound healing, contributing to the cellular dynamics of skin repair [Liu et al. DOI:10.1016/j.stem.2024.11.013].