Basic Information

Symbol
CCL3
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 3 MIP-1-Alpha G0S19-1 LD78ALPHA SCYA3 LD78 SCI Small Inducible Cytokine A3 (Homologous To Mouse Mip-1a) Macrophage Inflammatory Protein 1-Alpha Tonsillar Lymphocyte LD78 Alpha Protein G0/G1 Switch Regulatory Protein 19-1 C-C Motif Chemokine 3 PAT 464.1 SIS-Beta MIP1A Macrophage Inflammatory Protein 1 Alpha Chemokine (C-C Motif) Ligand 3 Small-Inducible Cytokine A3
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis

MANE select

Transcript ID
NM_002983.3
Sequence length
780.0 nt
GC content
0.5269

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-258.70 kcal/mol
Thermodynamic ensemble
Free energy: -275.76 kcal/mol
Frequency: 0.0000
Diversity: 185.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((((((((..((((.(((((((......))....))))))))).................((((((..........)))))).....)))))))))..).))))))..)))..(((..(((.(((.((..((((.((...(((.....))).(((((((.(((.((..(((((((..(((((((.((((.(((((((((((....))))))......((((.(((..(....(((((.....)))))....)..)))))))..(((((.....)).)))))))).)))).)).)))))...)))).))).)).))).........))))))))).)))).)).))).))).((((((..(((.(((((.((((((((.((....)).)))))(((..((((((((((.((((.....(((.((....)).).)).....))))...))).)))))))..)))..((((....)))).((((.((((((((((((.((................(((.((((....(((....)))....)))).))).....)))))))))))))).)))).........)))...)))))...))).))))))((((...(((.((((.(.(.(((((((((.((....)).))))))))))).)))))))(((((.((((......))))...)))))(((((.((((.....)))).)))))...((((((....)))))))))).......(((((...))))).....)))...
Thermodynamic Ensemble Prediction
.,.(((((({(((((((((..((({{(((((((......))....))))))))).{,,..........,..((((((..........))))))..,..)))))))))..}.)))))){{|{,..{{(..(((,(((.((,.((((,((,..(((.....))),(((((((.{(,,({.,((((((({{(({(({({((({.{(((({(((((....)))))}...,{.{{{{.{{{..|....(((((.....)))))...,}..)))))},..,,,,,.....))}))}))))),)))).,)})|||}..,|}}}.,)},)),))).,,}.....)))))))),.}})),)),)}),))}.}}}))},.((((((((((((((((((.((....)).)))))).((.(((((((.((((({({{{((((,{((({((((.((.((((.....))))))..((..,.....)),.,|||||||.}}}}||||,((((((((((((.,,.....,,..{((({,.{{{.,,{,..,.,,,....))}....},)},}}}.....)))))))))))))).))))....,,,,})}),,)).))))}})))},.)))))))))..(((.((((.(.(.(((((((((.((....)).))))))))))).)))))))(((((.((((......))))...)))))((,....}}}.))))).))))))),{(,((((((....))))))}))},.......,,{,,,,,||},....,))}...

Transcripts

ID Sequence Length GC content
AGAAGGACACGGGCAGCAGACAGUGGUCAGUCCUUUCUUGGCUCUGCUG… 780 nt 0.5269
Summary

This locus represents a small inducible cytokine. The encoded protein, also known as macrophage inflammatory protein 1 alpha, plays a role in inflammatory responses through binding to the receptors CCR1, CCR4 and CCR5. Polymorphisms at this locus may be associated with both resistance and susceptibility to infection by human immunodeficiency virus type 1.[provided by RefSeq, Sep 2010]

Forensic Context

A study in humans using integrative machine learning on multi-level molecular data from monozygotic twin pairs identified the CCL3 as a cytokine elevated in heavier twins within an immunometabolism component, associating it with obesity [Kibble et al. DOI:10.1098/rsos.200872]. In a mouse model of traumatic brain injury, pre-treatment with clodronate liposomes prior to injury reduced cortical expression of the CCL3 alongside other pro-inflammatory cytokines, correlating with neuroprotection, improved cerebral blood flow, and the emergence of distinct monocyte subsets [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8]. A study in mice demonstrated that the CCL3 (CCL-3) mRNA expression peaked at 5 days post-injury and was active throughout almost the entire wound healing process, having important effects on the inflammation phase and formation of granulation tissue [Wang et al. DOI:10.1111/1556-4029.12831].