| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGGACACGGGCAGCAGACAGUGGUCAGUCCUUUCUUGGCUCUGCUG… | 780 nt | 0.5269 |
This locus represents a small inducible cytokine. The encoded protein, also known as macrophage inflammatory protein 1 alpha, plays a role in inflammatory responses through binding to the receptors CCR1, CCR4 and CCR5. Polymorphisms at this locus may be associated with both resistance and susceptibility to infection by human immunodeficiency virus type 1.[provided by RefSeq, Sep 2010]
A study in humans using integrative machine learning on multi-level molecular data from monozygotic twin pairs identified the CCL3 as a cytokine elevated in heavier twins within an immunometabolism component, associating it with obesity [Kibble et al. DOI:10.1098/rsos.200872]. In a mouse model of traumatic brain injury, pre-treatment with clodronate liposomes prior to injury reduced cortical expression of the CCL3 alongside other pro-inflammatory cytokines, correlating with neuroprotection, improved cerebral blood flow, and the emergence of distinct monocyte subsets [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8]. A study in mice demonstrated that the CCL3 (CCL-3) mRNA expression peaked at 5 days post-injury and was active throughout almost the entire wound healing process, having important effects on the inflammation phase and formation of granulation tissue [Wang et al. DOI:10.1111/1556-4029.12831].