Basic Information

Symbol
CCL4
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 4 MIP-1-Beta AT744.1 SCYA4 LAG1 Small Inducible Cytokine A4 (Homologous To Mouse Mip-1b) Macrophage Inflammatory Protein 1-Beta Lymphocyte Activation Gene 1 Protein G-26 T-Lymphocyte-Secreted Protein Chemokine (C-C Motif) Ligand 4 T-Cell Activation Protein 2 C-C Motif Chemokine 4 MIP-1-Beta(1-69) SIS-Gamma PAT 744 Act-2 LAG-1 MIP1B HC21 Small-Inducible Cytokine A4 Secreted Protein G-26 Protein H400 MIP1B1 SCYA2 ACT-2 ACT2 G-26
Location (GRCh38)
Forensic tag(s)
Sudden death from CNS diseases Forensic psychiatry evaluation Wound age identification

MANE select

Transcript ID
NM_002984.4
Sequence length
660.0 nt
GC content
0.4742

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-179.70 kcal/mol
Thermodynamic ensemble
Free energy: -193.37 kcal/mol
Frequency: 0.0000
Diversity: 202.14
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((.(((..(((((....)))))))).))))))....((((....)))).............(((((((((.((((.((..(((((((((.((((((((((.........(((((((...(((((((....))))...(((((((....(((......))).......((.((((((((((........(((((((....)))))))...(((((((((...)))))))))((((.((((..(((....)))...)))))))).............)))))).)))).))..))))))).(((((......)))))((((((.(((....)))..))))))...)))...))))))).))))))))))))))...((((((((...((((((...(((((..((((...))))..)))))........))))))..........((((...)))).))))))))................)))))..)).)))).))))).)))).....((((((((((.((.((((..((....((((((.((((((((...))))).....))))))).))....))..)))).)).))))).))))).(((((((........))))))).........................))).
Thermodynamic Ensemble Prediction
.(((({(((({,((({(((,,,.{,{(|{{({{{{{|||{,{(,{({{....||||{,,.....,,},,,,.,,......,|{{(({{{({{{((((.{(((((((({...,,,||.{({{((|...,,,,{{|....)))|,..(((((((....(((......}}}.......{{.((((((((((.,......(((((((....)))))))...{((((((((...))))))))}((({,((((..{{({,..})),..)))))))).............))))))},))).)}..))))))).(((((......)))))((((((.(((....)))..))))))...}}}.,,))))))}.)))))))))))))),{|{(({,{{{...||||||...((({(..{(((...)))}..}}))),.......))))))},,}},.,)),})))),})))}}......,.,.,,{{{..,,,.,{|||}||,|||||,|.|,||{,||||,....((((((((((.{{.((((..{{....(((((,{((((((((...))))).....))))))).))....}}..)))).)).))))).))))).,{{||||,,,,,...))))}}|..}}},,.}}}}..}}},,.,,,..})}.

Transcripts

ID Sequence Length GC content
AGCACAGGACACAGCUGGGUUCUGAAGCUUCUGAGUUCUGCAGCCUCAC… 660 nt 0.4742
Summary

The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions. [provided by RefSeq, Dec 2012]

Forensic Context

A study in mice demonstrated that the CCL4 mRNA was significantly up-regulated and hypo-methylated three days after spinal cord injury [Ni et al. DOI:10.3389/fnins.2022.904573]. In human postmortem brain tissue, research found lower expression of the CCL4 gene in the dorsolateral prefrontal cortex of individuals with major depressive disorder compared to non-psychiatric controls [Pantazatos et al. DOI:10.1038/mp.2016.130]. A study in rabbits demonstrated that the CCL4 mRNA expression increased significantly at 3 hours post-incision, peaked at 5 hours, and normalized by 7 days, with no significant increase in postmortem wounds, indicating its utility for early wound age estimation and distinguishing supravital injuries [Bai et al. DOI:10.1016/j.forsciint.2007.07.006].