| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCACAGGACACAGCUGGGUUCUGAAGCUUCUGAGUUCUGCAGCCUCAC… | 660 nt | 0.4742 |
The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions. [provided by RefSeq, Dec 2012]
A study in mice demonstrated that the CCL4 mRNA was significantly up-regulated and hypo-methylated three days after spinal cord injury [Ni et al. DOI:10.3389/fnins.2022.904573]. In human postmortem brain tissue, research found lower expression of the CCL4 gene in the dorsolateral prefrontal cortex of individuals with major depressive disorder compared to non-psychiatric controls [Pantazatos et al. DOI:10.1038/mp.2016.130]. A study in rabbits demonstrated that the CCL4 mRNA expression increased significantly at 3 hours post-incision, peaked at 5 hours, and normalized by 7 days, with no significant increase in postmortem wounds, indicating its utility for early wound age estimation and distinguishing supravital injuries [Bai et al. DOI:10.1016/j.forsciint.2007.07.006].