| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUGCAGAGGAUCAAGACAGCACGUGGACCUCGCACAGCCUCUCCCACA… | 1299 nt | 0.5404 | |
| CCUGCAGAGGAUCAAGACAGCACGUGGACCUCGCACAGCCUCUCCCACA… | 1217 nt | 0.5399 |
This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokine s form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine , a member of the CC subfamily, functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligand s for the chemokine receptor chemokine ( C-C motif ) receptor 5 (CCR 5 ), and it suppresses in vitro replication of the R 5 strains of HIV-1, which use CCR 5 as a coreceptor. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
A study in humans demonstrated that the CCL5 is a core immune-related differentially expressed gene with diagnostic potential in both severe burns and blunt trauma, showing consistent expression trends in validation datasets [Chen et al. DOI: 10.3389/fgene.2022.1038222]. Separate research in humans identified the CCL5 as having high diagnostic value for post-myocardial infarction heart failure, with quantitative PCR validation confirming its expression increased sharply in patient blood samples [Sun et al. DOI: 10.3389/fimmu.2023.1163350]. A study in mice demonstrated that the CCL5 is a key chemokine upregulated during the inflammatory response to acute liver injury, where its mRNA expression was significantly elevated in liver tissue following LPS/D-GalN or alcohol induction and was effectively reduced by acetylcorynoline pretreatment, which inhibits the TLR4/JNK/NF-κB pathway [Fu et al. DOI:10.1016/J.Intimp.2024.113550].