Basic Information

Symbol
CCL5
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 5 TCP228 SIS-Delta D17S136E RANTES SCYA5 SISd Regulated Upon Activation, Normally T-Expressed, And Presumably Secreted Small Inducible Cytokine Subfamily A (Cys-Cys), Member 5 Eosinophil Chemotactic Cytokine Chemokine (C-C Motif) Ligand 5 T-Cell Specific Protein P288 Beta-Chemokine RANTES C-C Motif Chemokine 5 MGC17164 EoCP Small Inducible Cytokine A5 (RANTES) T-Cell Specific RANTES Protein T-Cell-Specific Protein RANTES T Cell-Specific Protein P228 Small-Inducible Cytokine A5
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_002985.3
Sequence length
1217.0 nt
GC content
0.5399

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-419.00 kcal/mol
Thermodynamic ensemble
Free energy: -440.52 kcal/mol
Frequency: 0.0000
Diversity: 382.91
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((....((..((((((.((((((((....((((.......))))....)).)))))).)).((((((....))))))........)))).))..))))))))(((((((.((.(((((((.....((....))((((.((((((((((((.((............((.....))...(.((((...(((((((((....((((....))))...(((((((((((((....((.((((((............(((((...))).)).......)))))).))..))))))..)))))))..((.(((....))).))((((((((..((((((....(((.(.....................).))).....)))))).))))))))(((((((.....)))).))).............))))))))).)))).)...........)).)))))))).........((((((..((((((((((.((((.....)))))))....))))).))..))))))....))))))))((((......))))(((.(((((..(((((((((((......((((......)))).......................))))))).))))..))))).)))(((((....)))))..))))))).)).))))))).((((.((((....((((((((((((((((((((.((((....)).))))))))(((((..(((((...((((((((((((...)))))................................(((((((((((((....)))))))))........))))...((((((((.((((((.....))))))..(((((((...(((((..((.((((.((.........)))))).))))))).)))))))......((((.......))))................))))))))....(((((((.((((((((((..(((((..(.((((....)))).).))))).)))))))....)))))))))).((((((...)))))))))))))..)))))..)).))).....(((((....)))))(((((.(.((.....)).).))))))))).)))))).))))......)))).(((((((..(((......(((....))).....)))...)))))))........))))...
Thermodynamic Ensemble Prediction
..{(((((((....{(..((({((,((((((((....((((.......))))....)),}))))).)),((((((....))))))........}))}.}}}.)))))))}{((((((.{{.(((((((......,{,{((,{{{(.({{{((,((((({(({((....,((((((((((.({({.(.(({(...({{{((((({{({((((....)))).}}|||||||,{{{{{,,..({.((((({.,.....,,,},,|.||...}})})}},.,,,,||}}}}.}}..)))))).,)||||}}..,,,|||..,{|||,||(((((((((,{(((((....(({,..{,{,...........,,...)))),.,...)))))))))))))))|((((((.....)}}}.,,,.......|{,,,,|}}}||||}.}|}}...,...,,{{{,{..||||||.}.........{{{{{{..{{||||{,,|,||||,....})))}}}..,,|||}}.}}.,)))))),,,,))))))))}{{{,..,,.(((((((.(((...,||,..))))))).....|{|{......)))),,,....................))})))))))),.)))))),||}|{(((....))})}..))))))).))})))),))..|||.|||,..,,|||((((((((,,(((((((.((((....)).))))))))}||||.,|||{{,{.,{{{{||(((((...)))))................................(((((((((((((....)))))))))........)))}...|||||||{.,,||||},...|||||{{.{{{{(((.{{((((({{(({((((.((,,.,,.,{,}}}}}}.))))))),)}}}}||{{|..{(({,.,},..}))))................,}||||||,..,(,{{(((,(({{({(((({{(((((,.{.((((.,..,}}),}.))))),)))}}},{{{{||||||}},|({,,{||...))))))))))})}},))}))..})},),,,,,.{((((....))))}||{{|}|}||}..,,))}).}}},,.}))))))))).)))}......}},}.{((((((,.(((.{{.,.(((....))),.}}.))).,,)))))))....},..,,,,...

Transcripts

ID Sequence Length GC content
CCUGCAGAGGAUCAAGACAGCACGUGGACCUCGCACAGCCUCUCCCACA… 1299 nt 0.5404
CCUGCAGAGGAUCAAGACAGCACGUGGACCUCGCACAGCCUCUCCCACA… 1217 nt 0.5399
Summary

This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokine s form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine , a member of the CC subfamily, functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligand s for the chemokine receptor chemokine ( C-C motif ) receptor 5 (CCR 5 ), and it suppresses in vitro replication of the R 5 strains of HIV-1, which use CCR 5 as a coreceptor. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]

Forensic Context

A study in humans demonstrated that the CCL5 is a core immune-related differentially expressed gene with diagnostic potential in both severe burns and blunt trauma, showing consistent expression trends in validation datasets [Chen et al. DOI: 10.3389/fgene.2022.1038222]. Separate research in humans identified the CCL5 as having high diagnostic value for post-myocardial infarction heart failure, with quantitative PCR validation confirming its expression increased sharply in patient blood samples [Sun et al. DOI: 10.3389/fimmu.2023.1163350]. A study in mice demonstrated that the CCL5 is a key chemokine upregulated during the inflammatory response to acute liver injury, where its mRNA expression was significantly elevated in liver tissue following LPS/D-GalN or alcohol induction and was effectively reduced by acetylcorynoline pretreatment, which inhibits the TLR4/JNK/NF-κB pathway [Fu et al. DOI:10.1016/J.Intimp.2024.113550].