Basic Information

Symbol
CCL7
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 7 MCP-3 NC28 MCP3 Monocyte Chemoattractant Protein 3 Monocyte Chemotactic Protein 3 SCYA6 SCYA7 MARC FIC Small Inducible Cytokine A7 (Monocyte Chemotactic Protein 3) Chemokine (C-C Motif) Ligand 7 Small-Inducible Cytokine A7 C-C Motif Chemokine 7
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_006273.4
Sequence length
810.0 nt
GC content
0.4025

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-206.20 kcal/mol
Thermodynamic ensemble
Free energy: -222.80 kcal/mol
Frequency: 0.0000
Diversity: 293.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((..((((((((((((..(((((((...((((....(((((((((.................))).)))))).(((((((((.((((....))))..((((((...)))))).......(((((....))))).((.(((..(((((((........)))))))..)))..))....(((((.((.....))))))).....)))))))))(((..((((.(((((((((..(((.(((((((......((..(((....((((((..(.(((...))).)..))))))....)))..))((((......))))(((((((.(((....)))..))))))).........((((((....)).)))).....(((((.((............)).))))).((((((((((((...)))))............)))))))))))))))))((((((...)))))).((((....))))((((..(((((((....))))))))))))))))))))))))(((((((((((..........))))))...)))))))).))))))))))).))))))........(((((.(((((.......))))).)).)))........((((.(((((((((................))))))))).)))))))))))))........(((((((((((((.((((..(((.(((((.((..(((..(((((.((((...)))).)))))....(((((((....))))))).)))...)).))))).))))))).)))))))))))))....
Thermodynamic Ensemble Prediction
,({((((((({{(((..,...,{{{{,..,,,,...,.(((((((((.{...............))),,))))).{(({{{{({.((((,,,,||||{{({((((..||)))}|,{{,...{((((....))))).{|.{{{,,(((((((........)))))))..))},,)),...(((((.((.....}}}))))..,,,))))||)))|||||||{{|||,.(({{...{((|,,|.|||}}}}..((,.(((....((((((..{.(((...})).}..))))))....)))..))|{{|,,,,,,)))}(((((((.(({....}))..)))))))...{,,{{{((...,{(({{{{{|||...,{(((,{.,|,,,.,,.....,||||||||,,{{{{{,((((,...,)))).......,,...}||||||{}}}})))))|||{{,.,.,{{{({{...((((((({{((((..{((((({....))))))}))))),,.))))))))))))}}.,||{{,,,{,,,,....})))}.,,||||,.},,))}))))))))))))))........((({(.(((((.......))))),)).))).,....,,},}||{{,,}}}.,)))})))}}.,,||,{||||||||||{|||||||.{((((.......,|||||,||||||,{{,,..,,,.|||{||||||||||,||||,..,||}}.,||}|||||}},,.{{{{(({....})))))}.,,,...,,.,,,,,.,}}}}}},,,}}}))))))},....

Transcripts

ID Sequence Length GC content
AGCAGAGGGGCUGAGACCAAACCAGAAACCUCCAAUUCUCAUGUGGAAG… 810 nt 0.4025
Summary

This gene encodes monocyte chemotactic protein 3, a secreted chemokine which attracts macrophages during inflammation and metastasis. It is a member of the C-C subfamily of chemokines which are characterized by having two adjacent cysteine residues. The protein is an in vivo substrate of matrix metalloproteinase 2, an enzyme which degrades components of the extracellular matrix. This gene is part of a cluster of C-C chemokine family members on chromosome 17q. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human patients with deep vein thrombosis demonstrated that the expression of the CCL7 was significantly increased in peripheral blood and was negatively correlated with microRNA-26a levels [Li & Ni DOI:10.3892/etm.2017.5183]. A study in rats demonstrated that the CCL7 is a factor split by MMP-2 to reduce chemotactic activity [Yu et al. DOI:10.1111/1556-4029.13001].