| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAGAGGGGCUGAGACCAAACCAGAAACCUCCAAUUCUCAUGUGGAAG… | 810 nt | 0.4025 |
This gene encodes monocyte chemotactic protein 3, a secreted chemokine which attracts macrophages during inflammation and metastasis. It is a member of the C-C subfamily of chemokines which are characterized by having two adjacent cysteine residues. The protein is an in vivo substrate of matrix metalloproteinase 2, an enzyme which degrades components of the extracellular matrix. This gene is part of a cluster of C-C chemokine family members on chromosome 17q. [provided by RefSeq, Jul 2008]
A study in human patients with deep vein thrombosis demonstrated that the expression of the CCL7 was significantly increased in peripheral blood and was negatively correlated with microRNA-26a levels [Li & Ni DOI:10.3892/etm.2017.5183]. A study in rats demonstrated that the CCL7 is a factor split by MMP-2 to reduce chemotactic activity [Yu et al. DOI:10.1111/1556-4029.13001].