| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGAGGUUGAGAACAACCCAGAAACCUUCACCUCUCAUGCUGAAGCUC… | 862 nt | 0.3968 |
This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils. By recruiting leukocytes to sites of inflammation this cytokine may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. [provided by RefSeq, Sep 2014]
A study in mice demonstrated that the CCL8 was upregulated in the striatum at 2 days post-traumatic brain injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528]. A review summarizing single-cell sequencing analyses in mouse models of myocardial infarction identified the CCL8 as a marker for repair macrophages, noting it was markedly upregulated in a specific macrophage cluster at 3 days post-infarction [Bian et al. DOI:10.3892/mmr.2025.13680].