Basic Information

Symbol
CCL8
RNA class
mRNA
Alias
C-C Motif Chemokine Ligand 8 MCP-2 HC14 SCYA8 Small Inducible Cytokine Subfamily A (Cys-Cys), Member 8 (Monocyte Chemotactic Protein 2) Monocyte Chemoattractant Protein 2 Chemokine (C-C Motif) Ligand 8 Monocyte Chemotactic Protein 2 Small-Inducible Cytokine A8 C-C Motif Chemokine 8 SCYA10 MCP2
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005623.3
Sequence length
862.0 nt
GC content
0.3968

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-222.30 kcal/mol
Thermodynamic ensemble
Free energy: -237.83 kcal/mol
Frequency: 0.0000
Diversity: 178.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((.(((..............))).))))))).(((.(((((.((((.(((((((((......((((((((...((((((((...(((.(((((......))))).)))....)))(((..((((((((........(((((((((((((..((.(((((.............)))))..((((((....)))))).....)).)))))).))......))))).........))).))))).)))..))))))))))))).........))))))))).((((((((..(((((((...(.((((((((.(((((..(.((((.((((((((.........(((((..((((((((((((..........))))).)).....)))))..)))))(((((.........)))))...........)))))))).((((((((........(((.((((((.((((...((.(((..(((((((.(((((.............)))))...)))))))..))).))...)))).)))))).))).......))))))))(((((((.((.((((...))))...)))))).)))...............(((((.(((((((((......))))))))).))))).)))).)...)))))...)))))))).).......)))))))....))))))))(((((((((...)))))))))....((((((...(((.....)))...)))))))))).)))))))).........................((((((((.........((((((((.....)))))))).........))))))))...........
Thermodynamic Ensemble Prediction
.(((((((.(((..............))).))))))).{((.(((((.((((.(((((((((....,.{(((((((,{{({(({(((...(((.{{((({,,...))))),)))....))){||,,|||||||{.||....,((((((((((({......(((((.,...........)))))..((((((....))))))...|.}}})))}}}}}}......},,}}.....,.,.,,}.))}}}.,)),,))))})))))}}}.........))))))))).((((((((..(((((((...(.((((((((.(((((...,((((.((((((((.........{{({...,,||||{(((((..........))))).,}{{{{{|,,{(((((......}))))}....,)))))...........)))))))).,{((((((..,.....{{{.((((((.((((.,,((,(((..((((({{.||{|{{{.{,,....,.})},,,,,,||}}}}}..))),))...)))).)))))).))}.......))))|||((((((((.((.((((...})))...)))))).))))},,...........(((((.(((((((((......))))))))).))))).)))).)...)))))...)))))))).).......)))))))....))))))))(((((((((...)))))))))....((((((...(((.....)))...)))))))))).))))))}}.....,,.,,,.,,,{,,,,{{...{((({{{,....{{{{{((((,,,,.}}}}))))),,,.........}))))))),},,..,,,..

Transcripts

ID Sequence Length GC content
AGAGAGGUUGAGAACAACCCAGAAACCUUCACCUCUCAUGCUGAAGCUC… 862 nt 0.3968
Summary

This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils. By recruiting leukocytes to sites of inflammation this cytokine may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. [provided by RefSeq, Sep 2014]

Forensic Context

A study in mice demonstrated that the CCL8 was upregulated in the striatum at 2 days post-traumatic brain injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528]. A review summarizing single-cell sequencing analyses in mouse models of myocardial infarction identified the CCL8 as a marker for repair macrophages, noting it was markedly upregulated in a specific macrophage cluster at 3 days post-infarction [Bian et al. DOI:10.3892/mmr.2025.13680].