| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCAGUCGCCGCUGCCAGCUCUCGCACUCUGUUCUUCCGCCGCUCCGCC… | 2038 nt | 0.5604 | |
| CUCAGUCGCCGCUGCCAGCUCUCGCACUCUGUUCUUCCGCCGCUCCGCC… | 1919 nt | 0.5466 |
Actins are highly conserved proteins that are involved in various types of cell motility and in maintenance of the cytoskeleton. Three main groups of actin isoforms have been identified in vertebrate animals: alpha, beta, and gamma. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. Actin gamma 1, encoded by this gene, is a cytoplasmic actin found in all cell types. Mutations in this gene are associated with DFNA20/26, a subtype of autosomal dominant non-syndromic sensorineural progressive hearing loss and also with Baraitser-Winter syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2017]
A study in humans demonstrated that the ACTG1 was differentially expressed between a female monozygotic twin pair, belonging to the least variable category of housekeeping genes in peripheral blood leukocytes [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. Another human study characterized the ACTG1 as a protein-coding RNA with high steady-state expression levels, used as a reference gene expression example [Djebali et al. DOI:10.1038/nature11233].