Basic Information

Symbol
CCNA2
RNA class
mRNA
Alias
Cyclin A2 CCN1 CCNA Cyclin-A2 Cyclin-A Cyclin A
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis Sudden death from respiratory system disease

MANE select

Transcript ID
NM_001237.5
Sequence length
2748.0 nt
GC content
0.4192

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-800.50 kcal/mol
Thermodynamic ensemble
Free energy: -856.65 kcal/mol
Frequency: 0.0000
Diversity: 583.43
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.((..(((((.(((...((((((((((((((.(((((((......)))..((((.((((((.((.(((((.((((.(((((.((.....)).).))))..))))..))))).)))))))).))))((((((((((((((((.(((((((((((.((....))..)))))..))))))))((((((.((((.((((((..(((.((((....))))..)))..))).))).)))).))))))(((...((.((((((((((.((.....((((((((.(((((..........))))))))))))))))))))))))).))...))).((((((((((((.((((((...(((.....((.....(((..((((((((.....((((((.((((((((((....)))))........)))))...))))))(((((.((......))..)))))......).))))))))))...)).....))).))))))...(((.(((.....))).))))))).))))))..))..............((((.((((((((....)))).)))))))).......))))))).....)))))))...............))))..))))))))))(((((........)))))...........(((((.(........).)))))(((..(((((.(((.....))))))))..)))...(((((((((((((((................(((.(((((((((((((((............(((((....((((((((((((((...(((((.((((.((..(((..(((..(((((..((......))..))))).....)))..)))....)).))))..))))).))).))))))))))).))))).....((((.(((((((((...............((((((((((....((((((((.........(((((....))))).........((((((((((((....((((((((((..((((.((((..((((..((((((.((...((((....))))......(((((((((((..(.(((((((.....)))))))..)..))))...(((((((..((((((....(((((((.((((((..((((((....))))))))).))).))))))).)))..)))..))))))).......((((((.((....((((........))))...)).))))))..........)))))))................)).)))))).)))).....))))..))))..))).....)))))))...))))))....))))))...)))))))).(((((((.(((........((........))((((((((......)).....)))))).))).)))))))((((((((((...(((((((....(((((...(((.((((.((..(((((............((((...........))))..((((((((((..............)))))))))).................)))))..............(((....))).......)).)))).)))...))))).....)))))))....(((((.((((((((((((((((((((((((((((((((((((((((......(((((........)))))...)))))))))).............(((((((...))))))))))))))......((((((.(((((((....))))))).)))).))..............((((((((.((....)).))))))))...))))))))(((((....(((((((...((((((..((...))..))).......((((((........))))))..........(((..(((((((((((((((.........)))).......))))))))))).))).........((((......))))...)))...)))))))..))))).....)))))))))))).)))...))))).....((((..((((((((((((((((((((((((......))))))))))))))....((((((....))))))))))))))))..))))..((......))............(((.....)))..))))))))))..((((((......))))))(((((...(((((..(((((((......))))))).))))).)))))..............))))).)))))(((.(((.......))).)))((((((((.(((((....))))).))))))))(((......))).....)))))))))..))))..))))))))))))))))))(((((.............)))))((.(((((.((((((((((..............(((...((((((((.(((((..(((((........)))))....))))))))))))).)))...((((((((((...(((((((((.......)).))))))).......((((((...)))))))))))))))).(((((((..........)))))))..))))))))))...))))).))....(((((((....)))))))))))))))).)))))).......))))......))).)))))..)).))((((((.(((.((.(((.............))).)))))..)))))).......
Thermodynamic Ensemble Prediction
((.((..(((((.(((..,((({((((((((((,(((((((......)))..{(((.((((((.((.(((((.((((.(((((,((.....)).}.))))..))))..))))).)))))))).)))}((((((((((((((((,(((((((((((.({....,}..))))),.))))))))((((((.((((.((((((..(((.((((....))))..)))..))).))).)))).))))))(((...((.(((((((({({((.....((((((((((((((..,....,..))))))))))))))))))))))))).))...))),{{((((((((({,({(({(....,,...|,||..,,((..((((((((({.....((((((.((((((((((....)))))........)))))...))))))(((((.((......))..)))))......}.))))))}}))..,)}},.,|||}.,))))}...{((.(({.....))).})})))),,)))))..))..............((((.((((((((....)))).)))))))).......))))))).....)))))))...............)))).,))))))))))(((((........)))))...........(((((.{........}.)))))(((..((((({({,..,,.))))})))..)))...((((((((((((((({,.,,.....{{{{{{(((.(((((((((((((({........{,.,(((((....((((((((((((((...(((((.((((.({..(((..(((..((((({,(({,...,))))))))).....)))..)))....)).))))..))))).))).))))))))))).))))).,.}}((((.(((((((((..........,,...((((((((((....((((((((.....,,..(((((....)))))....,,}}.((((((((((((....((((((((({,(((({{.((,,....|}.|}..}}}||,}}}|}})}}}..........{{{(({{((((..,.(((((((.....)))))))..}..))))...(((((((..,({(((....(((((((.(((({{..((((((....)))))))))}})).))))))).)))..},,..))))))).......,{{,,(,((....||||..|{{,,.|})},..}},}},}))}},}},....}}))))).}.........{{.{(((((((((........)),}))))))},},,||{{....)))))}}.,.)))))),...})))))...))))))))...(((,.,((((((....(((((((((((..{{(((((,......,|,{,..}||||}.,,....{{{{..,||,,..},,,,))}}..........(({..,,.,,.||,....|||||....,{{{{,..{{{(.....,,,,..||,,,.((((((((((..............))))))))))....||..|,..||||,,,..|,||,,|||,,...,{{{{,{,{{(({{.,,,{{..,|||||||,|{||}..|||..,}))}..,,,,.}}||,|,{{(((((....))))))),}||(((({((((((((((..,.,.(((((........})))),..)))))))))).......,.....(((((({...}))))))})))))},}}},.,))))))},,,,...))))))))))))))))))))),{{{...((((((((((((.((....)).)))))))}}))))...|||.((((((((((((.((((((....)))))).})){{{{{,,.,,,,((((((.,.....|)))))}.....,,,,.}}}}}(((((((((((,,((...{{{....,))}...,,.)))))))))))..(((((.((.(((((((...{.,(({{{,{{{,,{{{,......((((((((...)))))))),,)}))}....,,||{.{{{((((..((((((((((((((((((((((((......))))))))))))))....((((((....))))))))))))))))..))))},,}}}.}))))..,....))).}}}}...)).))))),,|||||,,,.||||||..,...,}}}},..,,.,},}}.,,..})))))))))..}}}.{({{{{{..,.,)))))},...........)))))}})))),,,,|{{.......)}}.,,,((((((((.(((((....))))).))))))))(((......))).....)))))))))..))))..}))))))))))))))}}|(((((.............)))))||.(((((,((((((((((..........,,..{{{..,((((((({.{((({..,{{(({,....,}}}}}}..,,})))))))))))).,)}...((((((((({...(((((((((.......)).)))))))......,{(((({...}))))))))))))))).{((((((..........))))))}..)))))))))).,,)))))}))}}},,{{{{||.,,,)))}}}}))))))))).))))))...,,.,))))......))).)))))..)).)}.{(((({(...,,.,...,..}}}}}}}..,,,.,.,,,...,}}}}.......

Transcripts

ID Sequence Length GC content
GGCGGGCUGCUCGCUGCAUCUCUGGGCGUCUUUGGCUCGCCACGCUGGG… 2748 nt 0.4192
Summary

The protein encoded by this gene belongs to the highly conserved cyclin family, whose members function as regulators of the cell cycle. This protein binds and activates cyclin-dependent kinase 2 and thus promotes transition through G1/S and G2/M. [provided by RefSeq, Aug 2016]

Forensic Context

A study in mice demonstrated that the CCNA2 was down-regulated in kidney tissue at 8 and 24 hours after whole-body irradiation with 10 Gy γ-rays, showing fold changes of 0.663 and 0.625, respectively [Zhao et al. DOI:10.1158/1078-0432.CCR-05-2418]. In human post-mortem tissues, the CCNA2 was down-regulated as part of the inhibited telomere maintenance pathway specifically in the lungs of patients who succumbed to septic shock [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in mice demonstrated that hyperoxia exposure significantly upregulated the CCNA2 mRNA level, suggesting a serious risk for developing fibrosing alveolitis [Shimada et al. DOI:10.1007/S00414-008-0226-6]. In human and mouse studies of heart failure post-myocardial infarction, the CCNA2 was identified as a hub gene in a specific fibroblast module [Wang et al. DOI:10.1016/j.ijbiomac.2025.143171].