Basic Information

Symbol
CCND1
RNA class
mRNA
Alias
Cyclin D1 U21B31 PRAD1 BCL1 B-Cell Lymphoma 1 Protein G1/S-Specific Cyclin-D1 B-Cell CLL/Lymphoma 1 BCL-1 Oncogene PRAD1 Oncogene D11S287E Cyclin D1 (PRAD1: Parathyroid Adenomatosis 1) Parathyroid Adenomatosis 1 G1/S-Specific Cyclin D1 BCL-1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_053056.3
Sequence length
4238.0 nt
GC content
0.5033

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1449.20 kcal/mol
Thermodynamic ensemble
Free energy: -1524.48 kcal/mol
Frequency: 0.0000
Diversity: 1284.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((..((((....)).))..)))))...((((.(.(((....))).)))))........((..((((((((((((((((((((((....))...((((((((((((((..(.(((.(.((((.((((((((((.........(((((((((.((((((.(((((..((((((((((..(((((.....)))))..)))...(((.((((((..(((((((..(.(((....(((..(((..((((.((((((((((((((((((.(((((((((((((((.((.((....((((((((....((((((.(((.(((.((((((.((((((..((....))..)).((((((...(((.(((.....((((((((.((((((((((.((((((((((((((.....((...((((((.((.((((.((.(.((........)).).)).)))).)).))))))..)).....))))))))))....)).))..))))))).))).)))...(((((.((.(..((...((......))..))..).)))))))(.((((((.(((.(....).))).)))))).)(((......))).((((.......))))........)))))...))).)))...))))))(((((....((((...))))..))))).......)))).)))))).....(((((((.(......)...)))))))(((....)))...(((.(((((..(((..(((((.(((((((...((((..((((..((((.........))))......(((((..........((.....))..........)))))(((((((((((....))).))...)))))).((((((.....)))))).((((.....)))).........(((((((.(((..((....))..))))))))))..))))..))))...))))))).))))).)))...))))).)))))))))))))))...))))))))...(((.....))))).))))))).))))))))))))))..(((((......)))))(((.((((((((((.(((((...(((...(((((((...((.((......)).)).)))))))((((....)))).)))...)))))...).))))))))).))).....)))))))))).)))).....(((..(((((..(((...........((((((............))))))..)))..)))))..)))................))))..)))..)))))).)..)))))))((((((((....(((((((((((.....(((...((((...............))))...))).....))))))))))).......)))).))))........))))))..)))(((((((........)))))))..((((((......)))))).......(((((......)))))..........((((.(((((......))))).))))(((((.((((..(((......)))..)))))))))...)))))))..))..))).))))))(((.((((.(((((((((((((..(((((((((((((.((((...)))).)))))))))....))))...))))))))).(((.........))).........((((((((......)))((((((((..(((((((((((......))))))....))))))))))))).....(((.(((((((.((((.((..........)).))))))))))).)))...)))))((((((..(((((.((((.(((...))).)))))).)))....))))))(((((((((((((((.(((((((..............))))))).....)))))...))))))))))((((((...(((.((.(((((((.....((....))......))))))))).))).)))))).....((((((..((.((((((((((((((((((((((((.((((((((((((((((..((((((..........)))))).)))).(((.(((((((((.((((....)))).)))))))))...))))))))))))))).)))))................(((..(((((..((((((.(((((((((((..(.(((.((..((((.((((((((((((((..(((.((.(((.(((((((..((....((((.(((((.(((.((((((((((........)))).((((...((((((.....))))))...))))((((((((((....))((((((((((((((.(((((.((.(((((...(((.((((((.....)))))).)))...))))).)).)))))))(((....)))))))))))))))((((((((..(((.((((....)))).)))))))))))....))))))))........)).)))).)))......)))))))))))..)))))))..((((.(((((.((((....(((.(((.......(((.((((...((..((((.....((((((........(((((((.(((((........))))).)))))))........))))))((((((((((((...(((((((.((((((((.(((.....))).......(((((((((.(((((((((((..(((((((.............))))))).)))..))))))))..)))).))))).......(((((((((((((((...((((..(((.(((((..((((.(((((...........)))))...)))).)))))...)))..)))).))))))))))).)))).....((((.(((.(((((((((((((((..(.(((((((..(((((((((((....))))(((.((.....(((.((.(((.....))).))..)))(((((.(.((......)).).)))))..)).)))..((((((((...))))))))....))))))).))))))).).))))))))))).)))).))).))))....))))))))..(((((..((((((((..((...........((((....)))).......))..))))))))..))))).....))))))).)))))))))))).....(((((((..((......))..)))))))......((((((.....(..(((((((((...((((....(((......)))...))))(((.(((((.(((((.(((((((((....))))))))).((((.((((((.((.(((.((.((.(((((((.....))))...))))).)).))).))..)))))).))))....(((((..(((.......)))..)))))..))))).)(((((((((((.((.((((........)))))).)))))))))))...........)))).))).........((((((((.....))))))))................(((((..(.((((.((((((((((((.....)))).......))))))))...)))).)..))))))))))))))..)))))))....))))))...)))).)))......)))..)))....))))))))).))))(((((..(((.....)))..)))))...........((((.......))))......(((.((.((((....)))).))...)))......))).)).)))...)))))..........(((.((((((......)))))).)))(((((((....)))))))...((((((((((((.....)).))))))))))..))))))))))))).)).))).)....))))))))))).))))))...)))))..)))(((.(((((.((...)).))))).)))..((.((((.....)))).))...)))))).))))))))))).)).))..)))))).)))).)))).)))...)))))).)))..((((((((((((.(......).))))))))).))))).)).))).)))...)))).).))))))))))))))))))..)))).))))).)).).))))))))..))...(((((((.....))))))).((((............((((..........))))..........)))).......)).
Thermodynamic Ensemble Prediction
.,.(((((((,,{{((....)).}),.)))))...((((.{.(((....))).)))))......{.((..((((((((((((((((((((((....))...((((((((((((((,{(.,.....{{||,,(((.(((((((((,..,,(((((((((,{((,.({{({{({{{((((({(((..((((,..,},)||||{{|||,|,{{{{(.{(({..(({({{{..,.,,,{{||{{,{{{((((,(({,,,.||||,,||,,.||||,||||||,,|||||,|.((((((..((((((((((.(((((({{((((((...((((((.((((((,.((....}).,||.((((((,,,(({.({{.,,,.((((({((.((((((({{(,|||,((((((((((.....||...((((((.((.((((.((.{.((........)).).)).)))).)).))))))..||.|...)))))))))),,..,,..,..))))))).))).}}}..,(((((.((.(.,((,..,,......}},.,},.|.}})))))(.((((((.(((.(....).))).)))))).),|,,,..},,,}.||||..,,,}})))),..},.,.)))))..,})).)))...}})))}(((((....((((...))))..))))).......)))).))))))...))).)))))))),,....,}.)))))),})))....))))))...,||||..{||,,|{{{|,|||||||,.,||||.,||||||||{|}}}||||,.{{{|{,..,.{,{{(,{,....,,,,{.||||||,,,....,,,|,((((((...(((((....))).))....)))))}((((((.....)))))),(,{{,,||.||||,..,,.||,(((((((.{||..((|||.)).,))))))))))..}}}|..||}}..,}}}}}|}.}}})).}||.||||||||||||{.||||{,|||||,,.(({{..|..,,,..}}}){{{{{||{||||{|{|.|(|||||.||{.(((((......))))).,||||,,},.,|}}}|.}}}})))}}})))}.})},,,,},.))))}((((((((.((({.,..,,....,.((((......))))..{(((((({,{((((({,((((,(((.{{{{(((({(({{{{..{,..(((.,..{{,.{{{{|.,,.,,,{,{..........{{.((({{...,}}})))}}},}...............,}}||,|||,,|,}}},)}.})}))}}}))))}|||||.,|,,({(((((((((.....{,,....||||......,.......},,,,.,)}}.,,..))))))))}))..))).))))))))))),.})))))).).))).)))))))),.|||,,,,,})))},..((((((......)))))).......|{{{,......,,||,...,,{,(((((((.{{(({....,,}))}},)||}}.,{{,{{{{...,.,,,,,,((((((((.......)))))))))}}),,}}|||||},|{,(({(({.,.{{{.,{((,(((..,,,,|||{{{(((.(({,.,,||}}.})))))})}...,)))}...)))})})))})).}},,,,||||||{........)),))}}}...,,,|.(((((((((..(((((((((((......))))))....)))))))))))))}....(((.(((((((.((((.((..........)).))))))))))).))){{{|||||{(((((..(((((.((((.(((...))).)))))).)))....)))))}(((((((((((((((.(((((((..............))))))).....)))))...))))))))))((((((...(((.((.(((((((.....((....))......))))))))).))).)))))}..||,{(((((,,||.|||{{((((((({{{{{(((((((.((((((((((((((((..((((((..........)))))).)))).{{{.(((((((((.((((....)))).)))))))))...}}}}))))))))))).))))))}.,,......,,...(((..(((((..((((((.(((((((((((..{.(((.((..((((.(((((((((,{((({,(((.,,..|}}.{(({{(.{(,...((((((({({{{{,....,|,.||||,,......||||,((((...((((({.....})))))...))))},.,,.{((((....((((((((((((...(((((({(..{(((|..,(((.({{{{{.,,,,)})))).})),..,}}}|{|,(((({...(((....)))....)))))))){(((((((..(((.((((....)))).))})))))))}{{((((....,,,.(((((.......)))))........))))))...))))...))))))))).)))...}}}.}.................}}}}}}}}||,.,|}}}}}....((((({.......,(((((((.{{{{|||,||..,|}}}},}}}}})},.......}})))}{(((((({{{{(,{((({{{{,.,{((((((.(((.....)))....,.,((({(({{{.{({(((((|((..(((((((...{{...||...))))))}.)))..)))))))}}.})))|,}}}).,,|.,,(((((((((((((((...{(((.,(({.((((,..((((.{((((,..........))))}...}))).}})))}.,))),.))}}.))))))))))).)))).}.,,||||.(((.(((((((((((((((,.{.(((((((..(((((((((((....))))(((.((....,(((.((.(((.....))).))..}))(((((.{,({......},.).)))))..)).)))..((((((((...))))))))....))))))).))))))).}.)))))))))))}}))).))).)))}.}},))))}}}}..{{{((..((((((((..,,.,,.,....},|{{{....}|},.......})},))))))))..||||}.|,||||||}}},)}}}}})))}}}.....(((((((..((......))..)))))))....,,,},}}})},||||.,}|||...})),,}}}},..,|,...{{((((((({|{((.((((((((((((({(((((((((....))))))}}}.,((({((((((.,..,(({(((,(((((((((({{{{||,,..}))))|{||{|||.,...))))))}},))}}}},{,|,}}||,}}}}}}.,,,..}},,,..,,}))}}|||||{(((((,({.{{{{...,,,,,||||||,|||||}|||||{,({....}},}}}|||{.,,,,,.,},({((((((.....))))))}|,,,.......,,.,..,,.||,,,..,,|.((((((((((({,,...}}}),.}},,.,))))))).|{{||{.|||||||{{{{{|||,|,{((((({(({....}}))}}}))|{,||||,,,,,,,|,}}}},,(((((({.((..(((.((((......)))}.))).)).)))))))..,,,,,||||.,}}},,)))),,))),||||||,,.,.,}}}))})}})}}}))))}}}}}))),}}}))},...},,,}}}})}})}.,|)))))).))..)}})))))))))|(((((((....))))))),..((((((((((((,....})}))))))))))..))))))))))))).)).))).,....))))))))))).))))))...)))))..)))(((.(({{{.{{...)}.))))),))).|((.((((|...})))).))}.,,))))),)})))))))}),)).)),.)))))).)).,,...,,},,...))))))))||..((((((((((((.,......}.))))))))).)))))..,.},),))}})))))))))))),))))))))))))))..)))),})))).)).),})))))))..)).}.(((((((.....))))))}.((((............((((..........))))..........)))).....}))).

Transcripts

ID Sequence Length GC content
AGAGGGCUGUCGGCGCAGUAGCAGCGAGCAGCAGAGUCCGCACGCUCCG… 4238 nt 0.5033
Summary

The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of human cancers. [provided by RefSeq, Dec 2019] CIViC Summary for CCND1 Gene Cyclin D has been shown in many cancer types to be misregulated. Well established for their oncogenic properties, the cyclins, and the cyclin-dependent kinases (CDK's) they activate, have been the focus of major research and development efforts over the past decade. The methods by which the cyclins are misregulated are widely variable, ranging from genomic amplification to changes in promoter methylation. While Cyclin D2 has only been found to be significantly deregulated in glioma, Cyclin D1 seems to be a pan-cancer actor. Cyclin D misregulation has been shown to lead to poorer outcomes in a number of studies, but currently there are no FDA-approved targeted therapies.

Forensic Context

A study in mice demonstrated that the CCND1 was downregulated in common in spleen leukocytes across all three injury models of trauma/hemorrhage, burn, and LPS infusion at the 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].