Basic Information

Symbol
CCND2
RNA class
mRNA
Alias
Cyclin D2 G1/S-Specific Cyclin-D2 G1/S-Specific Cyclin D2 KIAK0002 MPPH3
Location (GRCh38)
12:4269771-4306933
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001759.4
Sequence length
6493.0 nt
GC content
0.4553

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2025.80 kcal/mol
Thermodynamic ensemble
Free energy: -2152.95 kcal/mol
Frequency: 0.0000
Diversity: 2121.40
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((.(((((((((((((((((.(((((............(((.((...((.((((((..((.((((....)))))))))))))).)).)))....))))))))))..))))))((((.((((..((((((((...(((((((((......((((......(((...((((((.((..((((((......))))))))))))))..............(((((....)))))..))).))))......)).)))))))((((((((..(.((((.((((.....)))))))))..))))).)))((((((((......))).)))))((((...(((..(((((((((((((((((((((..((((((.((((..(((((((((.(.....).)))))))))(((((.((((((..((....(((.........((((((.(((((.((((((((((..(((.((((((((((((...(((.((((...((.((((((.(((((......................))))).)))))).))((((((....)))))).(((((((((((((.((((((((.((((((.((......((((.(((..........))).))))...)).)))...((((..((.(((......))).).)..))))....))))))))))).))).))).)))).)))....(((((.(((((((((....(((...((((....)))).)))...))))))).)).))))).((((.(((..((((...)))).))).)))).......)))).)))(((....))).))))))))))..)))))))).)))))))........)))))))))))......)))..))..))).))).)))))))))))))))...)))))))((((.((((((.((.(.(((((((....))))))).)..)).)))).))))))((.(((.........))).))..))))))).)))))))..))))))).))).)))))..)))).)))).((((.((.(((((...(((...((((((.(.....).))))))((((........))))...(((.(((((((..((((((.(((.......(((....)))(((((((((((.......(((((.(((((((((((((..(........)..)))))))..))))))...................(((((((((((((((...(((((((.................(((((.........)))))...(((((.(((((((((((((((.((((((((...(((((...((((((((.....(((((.....(((...(((((((...)))))))(((..((((((.....))))))..)))))).....)))))..))))))))..(((....)))((((.(((..((.......))..)))))))....(((((.......((((((((..........((((((((((((...((..(((((...(((((...........)))))...)))))..))..))))))))))))....(((((...)))))..........((((..(((.((((((..((((((((((((((.(((((.......((((.........))))(((((((((((((.(((((((((.....(((...)))..((((.........))))(((((((........))))))).............((((.((((.(((((..(((((....((((((...))))))((((((((........))))))))...)))))..)).)))))))))))...))))))))))))))))))..))))....((((((...(((....((..(((((.((((((((((......(((((((((((.......(((...((((((((.(((((((..(((....)))..))))........)))))))))))..))).........)))..))))))))..))))))))))))))).....(((((...)))))))....)))..)))))).......((((((((((((.(((((((((((((((((((......)))))...((((((....))))))..)))))))))))))))))....)))))))))))))))))))...........((((.....((((.(((((((((.((((.((((((...((((((.(((((...........)))))..((((((((((....)))))))))).........((((((((((((..((((((((.(((.((......(((......)))..........(((((..((((....)))).))))).(((.......)))......(((.(((((....(((((.(((((((...(((((((...(((((((....(((((((((((((.((((((((((((...)))).........(.((((((((((((((((((((((((((((((.((((...((((....))))....((((((.(((((...............))))).))))))...)))).)))))))..))))))))..............(((((....)))))((((((((((.......))))))))))................))))))))))))))).).(((((((((.......((((((............)))))))))))))))........(((((..(((((((((...(((....((((((((.((.....................(((((((((....((((((((....(((.......)))...((((.....((((....(((.(((...((((((((.(((((......(((((((.(((((((((.(((((((....))))))).)))........(((((....(((((.((((...(((((((..(((((.((.((((.((((((.((((((((((....(((((((.((((.((....)).)))).))).))))..))))))))..........(((((....((............))...)))))..........)))))))).))))..)).))))))))))))))))..(((((.(..((.....))..).)))))(((((((((((.((.......(((((....((....((((((....)))))).....))..))))))).)))))))).)))((((.((((......))))))))..))))))))))...((((((.......))))))(((((.((((((((((..((((((.((.......)).))))))..))))..)))))).))))).....(((((((..(((((...)))))..(((...))).....)))))))............)))))).))))...)))......))))).))))))))))))))..))))....))))))))))))....)))))))))..))))))))))....)))..(((((....)))))(((((((((..((.((((....))))))...))))).....))))))))))))).))))).((......)))))))))))))))))..))))))((((((((((.....(((((..((...)).))))))))))))))).(((((.(......).))))).((((((((..(((((((((...(((....(((..(((...)))..)))..(((((....((((.((........)).))))...((((.......))))((((((((...(((((((((((.((((((((((.((((((((((....((.((((((((((((((((((.(((...(((......))).))).))).)))))))))(((..((((.((((.((((........)))).))))...))))..))).((((..((((((((.((((..(((.....((((.(((((.....((((....((((((((....(((((((((((((((..(((..(((((((....((.((((((((((((((((((.(((((......((((((((((((.......((((.(((((((((((((.(((.((.((.(((((((.....(((......((((....(((((..((...(((((....))))).))..))))).((((......)))).......(((((...((((((((((.((..(((..........)))..)).)))))...)))))...)))))..))))))).....))))))))).)).)))))))....))))))))).))))..))))))))))))...))).)).)))))..)))))))..((.(((((((((.((((((..(((((......)))))..(((.(((......))).))))))))).)))))).)))))......))))))))...)))))))..((((((...(((((.((........)).)))))...)))))))))...)))))))..))))))))))))))))..))))))))).)))))))..)))).))).......)))))..))))..)))))).))......)))))..))))))))))..)))))))))))))))).........((((((..........)))))).))))))))..(((((((((.((....(((((((...((.((((((........)))))).)))))))))...(((((...)))))......((((.(((((((................)))))))))))....((..((((((((((((((..((((((((((..((.((((....)))).))...........)))).))))))....))))).........)))))))))..))...(((.((.((((((((....(((........(((....))).)))...)))))))).)).))).(((((((((.(((((((.(((.....))).)))))))....((((((........))))))((((((....(((.((((..((((................))))..)))).)))....)))))).)))))))))(..(((.(((.(((((((((...(((((((((..........).)))))))).)))...))))))..)))..)))..)....)).)))))))))((.((((((...))))))))(((((......)))))..))))).))))))))))))..))))))))........)))))))............)))))))..))))))))))))))))))))......)).))))))))).))..)))))))))))).))))))..)))))).)))))))).......((((((.((((...((((.((..((((((((....((((((((...(((((((((.....((((........((((((..(((...)))..))).))).......))))....))))))................)))...))).)))))))))))..))..))))))(((((....))))).)))).)))).))......))))).))))......(((((...........))))).......(((((((.((((.(((((((............))))))).))))...((((((((((((........)))).))))))))(((..(((((((((((((...............)))))).))))))).))))))))))(((((..(((......))))))))..(((((((...((........))))))))).....(((((((..((((((((((((..(((((.(((((..((((((((...((((....)))))))).))))..(((((((..(((((....)))))..))))))).))))))))))..))).....)))..))).)))..))))))).........))))....(((.....)))))))))))).....)))))).)))..).))).(((......))).)))))))).))))))))))...)))).))))...))))))))))))))).))))).....)))))))))))))))))))))).(((((....)))))...)))))......)).))))))).)).((((...))))))).))))))..)))))))))).......((..((((((.....))))))..))......)))....))))).)))))).((((((((....))))))))(((((((((((....)))..)))))))))))(((((....)))))))).)))))))((.(((((((((((((...((((((((((((((.(((.(((((.((((((......))))))..)))))..))).))....)))))))..)))))......)))).))).))))))))...
Thermodynamic Ensemble Prediction
.((({(((,(((,,.(((((((((((.(((((...........,(({.((...((.((((((.,({.((((....)))))))))))))).)).)))....))))))))))..)))))){{{|,||||,,||{(((({,,{(((((((((,....{((({......({{...((((((.((..((((((......))))))))))))))..............(((({....}))))..}}}.))))......)).)))))}|((((({{{.,|,{{(((((((.,,,,||}||||||,,||||}.}}|((((((((......}))|||}))(({{...(((..(((((((((((((({{(((((..((((((.((((..(((((((((.{.....}.))))))))){((((.{(((((..((...,({{........,{(({((,(((({,{(((((((((..(((.(((((((((((({{,(((.((({,{{(({(({{(({((,||,,}||||(((((.({{......||.,,,,})).)}))}||||({{{,||||||.{(((((((({(((.((((((((.((((((.((..{,..((((.(((..........))).)))).{,||.}}}.}}||{{..{{.(((......))}.).}..}}}}....})))))))))).))).))),))))},}},,|}|(((({(((((((((..({(((...{(((,.,.))}}.})).,.}}))}}).,|{}|||,..,,}}|,},}||||}},},}|||||||||,.},|,||)))}.}}){||....}}}.)))))))))}..))))})}),)))))),......,,}}}})))}))|......})}..))..))),,)}.))))}})))))))))...)))))}|(({,,{(((((..{,(.(((((((....))))))).}..|,.)))}.}}}}}){(,{((.,.....,,}}}.||..))))))).)))))))..})}||}}.})).))))}.,)))),)))).{{{{.{,.|{{{{||,|{{.,.((((((.(.....).)))))){{((.....,,.}}}}...(({({(({{({,|((((((.(((....,|.{{{,...})}||{{((((({{,|,||..{((((,(((((((((((((..{........|..)))))||||}))))).|||,......,.,,....((((((((((((((,...{{{{{{{{,.....,.........(((((.........)))))...{((({.(((((((((((((((.,((,,,,|,..,,,,,...((((((((..{{,{((((.....(((,..(((((((...))))))),((..((((((,...,))))))..)))))).....))))),,)))))))).{(((....}}|((((.({(..,(,{,,...|{{.|}||}}},...,||,|,}}....{((({{{{,,,,,,||..((((((((((((...((..{((((,..(((((.{{,...,,}.)))))...,)))),.)).,))))))))))))..},{((((...))))},....,.,|||({|..{{{.{{{{((,|((({{{((|(((({{(((((,......,{{{.........)}}|(((((((((((((.(((((((((.....{{,..,|||,,((((,.....,{.||||(((((((........))))))}...,,,,,,,|||(({{.{|||,{((((..{{,{{,,,.{{,,,.,,,}}}}},((({{{{|,..,,,,,))})))))...,||||.,||,}},}})))),),,,))))))))))))))))))..)}}}}.,,((({((.,,{{{...,{,..(((((.(((((((({{.,{{,.(((((((((((.......,,{,,{((((((((,(((((((..(({....}))..)))}.......,))))))))))).,))).........)))..)))))))),}))))))))))))))).....{,{{,...,)))))}}}..}}),,))}}}).....,,|(((((((((({,((((((((((((((((({{..,,..}}}}|...{{{{{|....,)))}}.,))))))))))))))))),...}))))))))))))))))))||,|,|}||||||||,,,,.,,||,|||||||||.{{((.({{(((...{(({{{|{{{{{.||....,,,,))))).}{(((((((((....))))))))))...,,,,,.((((((((((((..(({(((({.{{{.||..,,,,|||.,..,,)}),.........{((((..((((....}))).))))).(((.......}}|,{,.,.{{{.({(({...,(((((.((((({{...((((((({{.(((((({,{,.{(((({(((((((.((((((({{({{...,},,|||,.,{{,(,(((({((((({((({(((((((((((((({.{(((.,,({{(....}}}}..,,{{(({{.,,,{{.,,,{{.........))))).}}}}})},.))}},))))}||.,}))))))),,..,,,,,,,,,,{(((,..,.,||}|{(((((((((.......)))))))))).....}}}}.......})))))))))))))).,.{((((((((.,,,,{.{{{{{,..........}}))),,,))))))))}....,...(((((..(((((((({...,,,..,,((((((({.,,..................,,.(((((((((...,{{{{{{{{,,,.{{{,,.,||,}}}|,,,,(((.(((({......,,...||,(((({{{,.,|{{|,,,.....}}}|||,}}}}}},(({.(((((({....})))))).})}.{{{{{{{..((({.......))))..}))))))))))).))),.|,{{||,,,})}))},|((((......))))}{{({{(((({{({,,|||||||,.,,,,||||{{{{.........,(((((.(((((..((((((((.......{{(((({,.........,,..})).)))|,{.....,,,.,(((.....))))..)))))))).))))).)))))}..{{{{..,,|||,,,})}..},,,....,,,,})))))}}.,|||.{|||,{{{(({({((.{{{{{{|,,|}....,.....}.}))}|||.{|||},...,}}}}}}}}}}})),.}}|,}|}}||||||.,..{,,||({|(,,,,{||||.||||||||,,.}))))}))),..,|||||||||{{{|||,...,}}|}},.......,.{{{{{...(((((...)))))..,,}},||||{{|{.||,,,,|{{..((((((..((.....))..)))))).}},.,}))).},,.)}))))))).},,}}}}}}}}))))))))))}}....}))))))))..|}))))})}}....,}}}}(((({....)))))(((((((((..{,.{(((....))))},...))))).....))))))))))))).))))).||,,,...))))))))))))))))},.|)}))|((((((((((.....,{,,|,}||}},}},}))}}))}))))}}).|||||,|,,,,,}),)})}},{(((((((.,({(((((((...,{({.,.{((,.((,...)))..))||,|((((((,.{{{{,{|,,......)),))))},,|||.,,,,{{{|||.,(((((((,..((((((({(((,((((((((((.{(((((((((..,,((,(((({((((((((((((({((,..{((({{,...|||.,,,.))),))})))))}||||}||{,.,{(({(((({{{,,.{((({,..})}}}..|,|,}))),.....}||||((({,{{||{{{({{{,...{(({(({(({,,|,{{,|.|||({{({((((,{.(((((((((((((((.,(((,,(((((((....((.((((((((((({{(((({.(((((,,.,..((((((((((((.......((((.(((((((((((({{(((.((.(,{(((((((.....(((......{(((....(((((.,((...(((((....))))).)).,))))).((((......)))).......(((((...((((((((((.((..((({....}}}}.,))..}}.)))))...)))))...)))))..))))))).....))))))))),)).)))))))....))))))))).))))..)))))))))))).}.)}).}).}))))},)})))))..((.(((((((((.(((((,,.{((((......)))))}{(((.(((......))).})))))))).)))))).))}}},.....))))))})...))))))),,{(((((...((({{,((.,....,,}},}}))).,.})))}}||},,.}}})))),.))}})})}}}}|)}||||}}|||}}}||)))}},..,|||||,||.....,}}}}}}|}}}}},,,))))).}}.,....}}}},,,}}}},})))}..}))))}}))}}}}}}}|||,..,||{(((({,,{{..,,{{||||||,||||||||..{{{((((((,{,,,,.{((((((...,,.((((((........)))))).}}))))))}...(((((...)))))......((((.(((((((................)))))))))))...,{{,,((((((((((((((..((((((((((..((.((((....)))).)){{,,,....},)))).))))))....))))).........)))))))))..}|,|{({{.|{|(({((({{...,||{|.......|||,}.,})}})}},,.||||||||{,,{|||{(((,,,,,..,|||||,.,,,..,}}),,})))))))},..((((((........))))))||||{|,,|.{{{.{{((.{((({....},,,........}|||.,||||.,}},{,.||||}}.,,.)))),)}}.|,}.|||,|{{{{||||..,{(((((((,,{.,,.....}.)))))))),)}}}}}))}}})..})),.,,},.,....)),)))})))))||.|||{||...))))))),(((((......))))).})})),...,)))))))))..)))))))).......,}}))))).........,,.}}}}}}}.,||||||}}}}}})))))))}.,..,})}.))))))))),,)..)))))))))))),)))))}..)))))).))))||||{{....}|||||,.(({{..,|{{{{((..{{((((((,..,{(((((((...((((,,(({.....{(((........{({{{{..{{{...})),.)))}})).......}}}}{{{{|,||},......,,}}}}},,))))...))).)))))))))))..})..))))},(((((....))))).|}}}.}}}}.)).,,,..))))),)})),..,,,(((((........,..))))).......((((((({((((.(((((((.,,......,,.))))))).)))}...((((((((((((........)))).)))))))).,{,.(((((((((((((..{,.......,,,.)))))).))))))).}))))))))),{(({..{{{,....,}}}}))}|{,(((((((...{{........))))))))),},,.,||||||,.|,,{({{,,.,},,.(((((({...,)))))),,{,,,{{{{....|||||,,,.))))}.{((((((..(((((....)))))..))))))},||||||||{....,..}))))))},,,,,,,},.)))))},,,,,.,.,,))),.,,||{{.....))))}}}))))).,,.,))})}}.))}.,).)))}|||..}},}}}}.))})))))))})}}))))).,.))))})))),..))))))))))))))).)}))).....}}}}},.}))))))}))))))},|||||},..,,}}}...||}}}|,....,,.})})))).),,||{{...))))))).))))).,,}}}}|||||||.,,...({..((((({..,,,||||||,,||,.|||,}}|,,..}}}||,|||}}},((((((((....))))))))|(((((({(((....)))..)))))))},,.{((((....)))))}},.}}}}}}}((.((((((({(((({...{{{{{{{(((((({.{((.{((((.{(({{{......)))))),.))))),,)}),))}...,)))))),,))))),.....}}}}.))),)))))))}...

Transcripts

ID Sequence Length GC content
NM_001759.4 NCBI
AGAGCGGAGAAGAGCGAGCAGGGGAGAGCGAGACCAGUUUUAAGGGGAG… 6493 nt 0.4553
Summary

The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK4 or CDK6 and functions as a regulatory subunit of the complex, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. Knockout studies of the homologous gene in mouse suggest the essential roles of this gene in ovarian granulosa and germ cell proliferation. High level expression of this gene was observed in ovarian and testicular tumors. Mutations in this gene are associated with megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (MPPH3). [provided by RefSeq, Sep 2014] CIViC Summary for CCND2 Gene Cyclin D has been shown in many cancer types to be misregulated. Well established for their oncogenic properties, the cyclins and the cyclin-dependent kinases (CDK's) they activate have been the focus of major research and development efforts over the past decade. The methods by which the cyclins are misregulated are widely variable, ranging from genomic amplification to changes in promoter methylation. While Cyclin D2 has only been found to be significantly deregulated in glioma, Cyclin D1 in particular seems to be a pan-cancer actor. Cyclin D misregulation has been shown to lead to poorer outcomes in a number of studies, and currently there are no FDA-approved targeted therapies.

Forensic Context

A study in humans demonstrated that the CCND2 is a WNT pathway target with expression significantly higher in the fibroblast subcluster FB1 from patients with organic erectile dysfunction compared to normal tissue [Zhao et al. DOI:10.1038/s41467-022-31950-9].