Basic Information

Symbol
CCNDBP1
RNA class
mRNA
Alias
Cyclin D1 Binding Protein 1 DIP1 GCIP HHM Grap2 And Cyclin-D-Interacting Protein D-Type Cyclin-Interacting Protein 1 Cyclin D-Type Binding-Protein 1 Cyclin-D1-Binding Protein 1 Human Homolog Of Maid Grap2 And Cyclin D Interacting Protein MAID Protein
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation

MANE select

Transcript ID
NM_012142.5
Sequence length
3515.0 nt
GC content
0.4242

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1008.70 kcal/mol
Thermodynamic ensemble
Free energy: -1075.35 kcal/mol
Frequency: 0.0000
Diversity: 808.75
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((((((((.........)))..))))))))).(((((((((.(((((((((..(((.(((((((((........))))))....((((((((..(((...((((....)))).))).........((((((((((((..(((((...)))))((((((((.((((((((.......)))))).)))))))))).....))))))).)))))...........((((((..((.(((.....))).))..))))))..(((.((((......)))).)))((((((((...((....(((....)))...))...)))))).))))))))))(((((((..........))))))).))).)))..)))))))))..((((((((...((((........)))).(((...)))((((((.....))))))....((((((.....((((.((((.((((((.(((((.(((((..((((((((((((((.....))))))............))))..))))....))).)).....)))....)).)))))))))).))))))))))))))))))(((.((.(((((((.......((....))))))))).))))).(((...(((((.(((((....))))).))))).......))).((((((((((.(((((.((((.........((..(((((.(.......).)))))..)).(((((((.....((((.(((((..((((.(((((((....)))))))))))...))))))))))))))))........((((.(((((.....(((((((((....))))).))))...........(((((.....)))))........((((.((((((((..((.((.((((((((((((((((.((..((((..(((....)))))))..))))))..(((.(((((((.....(((...)))...))))))))))))))))))))))..((((........(((..(((((........)))))..)))((((.((((((((((((.......(((....)))...(((((.........)))))...........(((((..(((..(((((((.(.((((..(((....(((((...((...((((((.((((((.........)))))).))))))))...)))))....)))..)))))))))))))))..))))).(((((((......))))).))....((((((((((.((.(((.....))).))...)))))))))).(((((....(((((.(((..(((((((((.((((((.......(((((((((((.((((((..((((((((((((...)))).))))))))..)))))).........(((((((......))))).)).......((((((..............((((((((.(((........))).))))))))((((((..((((((((((.....((......))((.(.((...)).).)).....(((..((((((.......))))))....))))))))))))).)))))))))))).....))))))))))).....))))))..)))))))))....((((((((((...................(((((((.........)))))))............(((((((......))).)))).....))))))))))....((((((..(((.(((((.............))))).)))...))))))((((((((..((......))..))))))))........(((((....))))).))).))))).....)))))......((((((.........)))))).....(((((((((((.....))))))))))).)))))))))))).)))).(((((((((((....(((((((....................))))))).((((((...))))))..........((.((((((.(((......))).)))))))))))))))))))((((((((.....))))))))(((((....((((((((..(((.....(((((.........))))).....)))....(((((((.............))))))).(((((((((..((((((((...))))))))..))).....((((((((((((((((..(((.(((((.(((.....))).))))).((((....(((((......)))))...))))......(((((((((((((((((.........(((((...)))))................................(((((...))))).))))))))...))))))))).(((((.....(((((((((..((((((((((......((..(((((((...(((..........)))...)))).)))..))......)))))))))).....))))))))).....)))))(((((((........(((........))).........)))))))..((((((((((((((((((...(((((((........))))))).............................(((.((((((((...))))))))...)))((.(((((((((((((.(......))).)))))))..))))))....(((((((....(((..(((.(((.((((((..(....)..)))))).))).))))))..(((.((((.((..(((((...........))))).)).)))))))........(((((.((((((((.(((...(.((((....)))).)....((.((((((....(((((......))))).....)))))).))....))).)))))))).)))))((((((....))))))................((((....(((.(((((.((((............))))..)))))...)))....))))(((.((((..(((((((....)))))))..)))))))...((((......)))).)))))))................)))))))))..)))))))))....((((...)))).((((((((((((........)))))).)))))).)))..)))))))))...))))))))))))).....(((..(((((.((((.(((((((......((((.((((..((...((((((.(((((.......))))).))))))....(((......))).))..)))).))))..))))))))))).)))))..))).....)))).)))))))))))))..........)).))..)))))))))))).))))).))))(((((.(((((.((((((...(.....)...))).))).))))).)).)))..))))...))))).))))))))))...)))).)))))..........................
Thermodynamic Ensemble Prediction
...{,.((({({({{((,..{{{{,((((((((.((((((({{((((.,((((.((.{((((((((.((....}))))))))},}..)).))))...},).)))))),,))))....))))))))..,|,,,.,((((((((((((..{((((...))))}((((((((.({((((((.......)))))).)})))))))).....)))))))))})))...,..,,...((((((..((.(((,...,))).))..))))))..{{{{({(((((.(((({{{{{{,{(({(({...{{....{{{...,)))...,,.,.)))))).}}}}}|,,,,(((((({..........})))))).}},,}}}||.}}|||}.},,.|(((.....}||,..{{{{{{...{{{({{...,,.((((((.....))))))..,}))))))))|||||{{{{|{||||,,.,,},)),)))),(((((((((((.,(((({....))))||{{......(((((....))))).....))}).,{{{{{{,.......((((((((({{((,,....))),,,)))})))))))..,|||},,.......,,(((({{....)}.)))).,{,...(((((.(((((....))))).))))).......})}.((((((((((.(((((.((((......((((((((((((((.{{...{((.((({...,{(((((((,...,({(((((..,.}||||}}||||||}}}}))))))),)))}}}........))))))))...,.,,.{(((.((({,.{{((({((...||),))),))}{||{{{{.,,..,,..,,,,|,....)),))}}}}}{(.(((({((((((((..({.((.(((((((((((((((({{(..((((..(((....)))))))..})))))..(((.(((((({.,.,.(({...)))..,)))))))))))))))))))))),,((((........{((..(((((........)))))..))|((((.((((((((((((...,...(((,{.{||,.,{{,((({({..{{{.,|||{...........(((((..(((..(((((({.(.((((..(((....(((((...,,...((((((.((((((.........)))))).)))))))....)))))....)))..))))}))))))))))..))))).{{(((((......))))).}}....((((((((((.((.(((.....))).))...)))))))))).,,{,{....,||||..||,.}||||||||.(((({{,,.,{{,({,{{((((((.{(((((..(((((((({(({...,))).))))))))..)))))|.....,...{{(((((......))))).)}.....,,({{{((.............,((((((((.(((........))}.))))))))||((((..{((((((({|.....((......}},|,|...,..||{|,,|,...,({{..((((({.......}))}}}....))))})))))))}.)))}},))}))).,,,}))))))))))).....}}}|||.,}}}}}}}}||,{,((({{((((,........,,,,..,,,,.(((((((.........))))))).,,,........{(({{{(......))).)))}.,...))))))})),..,.{{((({..(((.(((((..,......,,..))))).))).,.}))))}{(((({{{..,|,,,...,},,)))))}}}........{((((,...}))}}.,.,.|||||{{{{{,||,...,,.}|||||,.}}}},...||},,,.....{((((((((((.....))))))))))).)))))))))))).)))),{((((((((((....{((((({....................})))))|.((((((...)))))).....,,...,|,|||||{.{{{......))).}}}}},,,))))))))))}((((((((.....))))))))(((((....((((((((..{((.....(((((..,....}.))))).....}}}....(((((((.............))))))).(((((((((..((((((((...))))))))..))).....((((((((((((((((..(((.,{(((.{{{.....}}|.))}}|{((({....(((((......)))))...)))}})}}..(((((((((((((((((.........(((({...})))}.,..............................,||||...,}}}}.))))))))...))))))))).(((((.....(((((((((,.((((((((((....,.,{..(({{{{{.{,(((....,.,,..}}}...,}}}.)))..},......)))))))))).....))))))))).....)))))||||||,.,,,,..|{{|||.|,|.,.,|.,,.....|||||||,..((((((((((((((((((,,.(((((((........))))))).,...........................,,{,((((((((..{{||||||,.{{{,{(({(((((((((((((.(......))).)))))))..))))||,,..,{(({{,..,,((,...,,.,{||||,|||},.....}.})))))).,.)}))).)),.(((.((((.((..(((((...........))))).)).)))))))........(((((.((((((((.(((...{.((((....)))).}....((.((((((....(((((......))))).....)))))).))....))).)))))))).)))))({((((,,.,|}}}}},,.}}}}}}.}}}},|(((({...}))))}}|||}}},}}}|.,{{{{{.|{,{{{{,||,{{{|||..{||||,{{,.((((..(((((((....)))))))..)))),,,...||{{..,,,.})))}))))}))}}}}.}}}}}.}}}..}))))))))}.,)))))))).....,,...})))}.{(((((((((((........)))))).)))))}.)))..)))))))))...)))))))))))))...,.{{{..(((((.,(((.(((((((......((((.((((..((,..((((((.(((((.......))))).))))))...,(((......)))}})},)))).))))..))))))))))}.)))))..}}}.....)))).)))))))))))))...........},))..)))))))))))))))))).)))}(((((.(((((.((((((.{,{.....).,,))).))).))))).))},))..))))...))))).)))))))))).)))),.})))))}.....,)}}}...............

Transcripts

ID Sequence Length GC content
CUUGACGCUGUGGCCCGGAAGUGGAGCGGCUGUCGCAGUGCGGCUCCGG… 3515 nt 0.4242
Summary

This gene was identified by the interaction of its gene product with Grap2, a leukocyte-specific adaptor protein important for immune cell signaling. The protein encoded by this gene was shown to interact with cyclin D. Transfection of this gene in cells was reported to reduce the phosphorylation of Rb gene product by cyclin D-dependent protein kinase, and inhibit E2F1-mediated transcription activity. This protein was also found to interact with helix-loop-helix protein E12 and is thought to be a negative regulator of liver-specific gene expression. Several alternatively spliced variants have been found for this gene. [provided by RefSeq, Apr 2009]

Forensic Context

A study in human body fluids (blood, semen, menstrual blood, vaginal secretion) using a custom mRNA MPS primer panel investigated the CCNDBP1 for time since deposition estimation [Hänggi et al. DOI:10.1016/j.fsigen.2025.103415].