Basic Information

Symbol
CCR5
RNA class
mRNA
Alias
C-C Motif Chemokine Receptor 5 CC-CKR-5 IDDM22 CMKBR5 CKR-5 CD195 CKR5 Chemokine (C-C Motif) Receptor 5 C-C Chemokine Receptor Type 5 HIV-1 Fusion Coreceptor CCR-5 Chemokine (C-C Motif) Receptor 5 (Gene/Pseudogene) C-C Motif Chemokine Receptor 5 (Gene/Pseudogene) C-C Motif Chemokine Receptor 5 A159A Mutant C-C Motif Chemokine Receptor Chemokine Recptor CCR5 Delta32 Chemokine Receptor CCR5 CD195 Antigen C-C CKR-5 Chemr13 CHEMR13 CCCKR5
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001394783.1
Sequence length
3358.0 nt
GC content
0.4500

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1065.40 kcal/mol
Thermodynamic ensemble
Free energy: -1128.57 kcal/mol
Frequency: 0.0000
Diversity: 831.43
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((...(((..((((.((((((((...(((...)))....))).)))))..))))..)))....((((((((......)).))))))...................(((((............(((((......))))).(((((((((((.........((((...(((((.........((((..(((((....(((.((((((((((((.(((.............))).)).)).).))))))).)))...)))))..))))((((((((((((((((.((((((((((((.((((.(((..((((((.((......))..)))))).)))((.(((......))).))(((((...))))).((((.((((...)))))))).((((((((..(((((((....((((((((..(((((.(....(((((((((.(((((((((((((....((((...))))....(((((((((.((.(((((((.((....)).))))))).)).)))))))))(..(((.(((((((......((((((((((.((((((........))))))..........(((..(((((.((((((...(((((.........(((((((....))))))).....(((((....)))))..)))))(((((..(((((((((.((.((((((((..(((((..((..(((........((((((....((.......))....)))))).((((((((..((....(((((....((.(((.((((((((....(((((.((((((((......(((((((((((((.(.....((((((((..(((((((((((.(((.(((...(((((......)))))...)))..))).)))))..)))))).))))))))(((.(((....))).))).((((..((..........))..)))).....(((...(((((.((((..(((((((((....(((...(((((....(((((((....((((((.......((((((..(((((((((.(((..(((((((((........((..(((.....)))...)).........)))))))))..(((........)))((((((....))))))(((((((((((...(((((..((((.(((.(((....(((((.((((((((..(((((((..((((....))))((((.....(.((.(((((..(((...(((((((((..(((((((.((((((((((..((((...)))))))))))...........)))..)))))))......)))..))))))...)))...))))).)).)....)))).......((((....))))....)))))))))))))))...)))))....))).)))..))))..)))))(((.((((((...)))))))))((((((....)))))).((((((.......)))))).....)))))))))))...(((((((((..(((((......)))))...))))......((((((((((..((((....(((((((..(.(((((((..((.(((.........)))))...))))))).)..)))))))..))))((.(((((..((((((.....)))))).))))).)).))))))))))...)))))...))).))).))))))((((((........)))))))))))).........)).))))....)))))))..((.((((.....))))))))))).....)))...))))))))))))).)))))..)))....).)))).))))))))).......((((((.....((((((((.......))))).)))))))))(((((.((((.....)))).)))))((((((((.(.....)))))))))...))).))))).))))))))))))).)))))....)))))...)).)))))))).))))).))))).))))))))..)).)))))....))))..))))))))))))))))..)))...))))))))))...))))))).)))..)..)))))))....))))).).))))..........)))))....).)))))..)).))))))..))))))).))))))))..((.(((((((......))))))).))....(((((.......))))).)))))))))))))))).)))))...........((((((((..(((.((....((.((((.(((((((((...))..)))).))).))))))...)).)))..))))))))..(((((((((((((.(((((((((..(((((((((.((((..((((((((((...(((((((....)))))))................((((((((...........))))))))..((((....))))..((((((((.......)))))))))))).)))))))))).))..))))))).)))))))))......)))).))))))))).........((.((((((..((((.....((((.(((.....))).))))...((((((.(((.((((((.((...(((..((((.((....)).))))..)))......))..))))))...))).))))))....(((((((((........)))))))))..(((((....)))...))((((((((........(((((((((.((((.(((((...((((.....(((((....))........(((.(((((((...(((...)))))))))))))))))))).....))))))))))))))))))))))))))............((.(((((((((((.(.((((((.(((((((((((((((((((((((..........))))))))))))))))))))))).)))))).).)))))))))))))((((((((((........))))..)))))))))))))))).)))))))))))))....))))).))))))))..))))).))........((((((....)))))))))))....(((((((((((((........((((((((((((((((((((.(((.....(((.((((.(......).)))))))...)))((((..((((((((.....)))))))))))).....)))).)))))))....))))))))).((.(((........)))))..(((...))))))))))))))))......(((((((((((..((((((((...)))))...)))....))))..)))))))...............))))).......
Thermodynamic Ensemble Prediction
(((((.{.{((..((((.((((((((...{((...}))....))).)))))..))))..}}}.,..((((((((......)).)))))).............,,{,.,(((((,...........{((({......})))),{{{|{{|||{{{{{,.|||,{,{,...{((({{{,,,,,,.((((..(((((....(((.{(((((({((({.(((.............))).))}.)}).))))))}.))}...)))))..)}}}((((((((((((((((.((((((((((((.((((,(((..((((((.{,......,}..)))))).))){{.{((......))}.}|(((({...}))))},{({.(({{...,}}||}|{{{{((((((..(((((((....((((((((..(((((.(....((((({(((,{((((((((((((,.,.((({...}))).||.(((((((((.((.(((((((.((....)).))))))).)).))))))))){..(((.(((((((......((((((((((.(((((({.....}.))))))..........(((..(((((.(((((({,.(((((..,......(((((((....))))))).....{((((....}))))..))))){{(((..(((((((((.((.((((((((..(((((.,{,..{{{.....,{{(,((((..,.{{....,..))}}.,)))}},.((((((((..((....(((((.,,.,{.(((.((((((({.,.,(((((.((((((((....,.{((((((((((((.(,,.,{{{((((((.,(((((((((((..,,.{{(,..(((((,.....}}})),,.},}||}}},)))}}..}}}}}}.}}}}|||,(((.(({....})).))).|||(,.{(,,,..,,,..}},,))}}....||||...{((({.((((..(((((((((....(((...(((((....(((((((,...{(((((,,,.,,,(((((({((((((((((.(((..{{{{{|||,.....,.(({{.{{{..|,|)|,,,,|,.....||||||}}}}}}}..||{,,,|||..)))|||{||,,.,||||||(({(((((({,.,,(({{{..{{{|,||,}|||}},,|||||,||{((((({.(((((((..((({....}}})||{{.....,.,,.(((((({(((...(((((({(({{(((((((.((((({{{{{..{{{{,,,}))))))))}}.........,,)))..)))))))..,...}})..))))))...)))..,)))))},,,},,,,)))),,.....((((....))))....}||||||,}}}}}}}.,,|||}}....|||,|||,,,}}}..}}}}}((({{(((({...))))))))}((((((....)))))).((((((.......))))))..,,,))))))))))},..{{{{{{{{,,,(((((,,.,..}}}}}..,}))}},....(((((((({{,{(((({{..(((((((..(.(((((((..,,.{{{.........)}},,...))))))).)..)))))))..,,,}|,.(((((..((((((.....)))))).)))))}))})))))))))),,,)))))}}}))).))),,)))))}|{{{{..,,....))}}}|}}}|}}...,,,...)),))))..,.)))))))..{{.((((.....))))}))))))...,,))).,.))))))))))))).))))),}}}},.,.}.))))))))))))))}|||||.{(((((.....{{{(((((......,))))).)))))))))||||{.|||||,,.})))).}|)))|||{(((|||.....})))))))),..))).))))).))))))))))))).)))}),...)))))...)).)))))))).}))}}.))))).))))))))..)).)))))....))))..))))))))))))))))..))}...))))))))))...))))))).)))..}..)))))))....))))),),}}}}|,.....,,,}))))....).)))))..)).))))))..))))))).))))))))},.|,||{{(((,,,,..,}}))))}))....(((((.......))))).)))))))))))))))).))))).,},||,.,..{{((((((.,(((.((....((.((((.((((((({{...}}.,)))).))).)))),)}..)).))),.)))))))}..||||,{(((((((.(((((((((..(((((((((.((((..((((((((((...(((((((....)))))))................((((((((...,.......))))))))..((({....})))..((((((((.......))))))))}))).)))))))))).))..))))))).)))))))))......{((((((({||||{.............,,,,,...{{......{(({,{(({.{((..,,,|}}.,.||,||}}|,..,|{,||,}},..{((..((((.((....)).))))..)))......)),}))))))))))),.,,,|||....(((((((((........)))))))))..,,{{{....)))...}}((((((((........(((((((({{((((.(((((.{.((((.....(((.,....|,......,.((,,(((((((...((,...,))))))))))))))))))).....))))))))))))))))))))))))))........}}}}}|}{((((((((((.(.((((((.(((((((((((((((((((((((..........))))))))))))))))))))))).)))))).).))))))))))},,((((((((((........))))..)))))).}},}}},,}.}}))))}})}))}...}))}}..,},.,)))},})))),))}.......((((((....)))))))))))..|,{((((((((((((........((((((((((((((((((((,,{{{....{{.,((((.{......).)))))}},,|||,{(((..{(((((((,....))))))))))))}},..)))).)))))))....))))))))).((.(((........)))))..(((...))))))))))))))))..|,..(((((((((((..((((((({...}))))...))).,..})))..}))))))..,,...........))))).......

Transcripts

ID Sequence Length GC content
CUUCAGAUAGAUUAUAUCUGGAGUGAAGAAUCCUGCCACCUAUGUAUCU… 3661 nt 0.4433
CUUCAGAUAGAUUAUAUCUGGAGUGAAGAAUCCUGCCACCUAUGUAUCU… 3426 nt 0.4498
AGAAGAGCUGAGACAUCCGUUCCCCUACAAGAAACUCUCCCCGGGUGGA… 3358 nt 0.4500
Summary

This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]

Forensic Context

A study in porcine skin demonstrated that the CCR5 was significantly increased at both 24 hours and 7 days following cutaneous bromine exposure, regardless of exposure duration (45 seconds or 8 minutes), and was identified as a potential therapeutic target involved in IL-10 and hepatic fibrosis/stellate cell activation signaling pathways [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. A study in mice demonstrated that spinal nerve ligation induced significant whole-transcriptome changes in injured dorsal root ganglia, with the CCR5 being upregulated 7.05-fold six days post-injury [Wu et al. DOI:10.1177/1744806916629048].