| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUCAGAUAGAUUAUAUCUGGAGUGAAGAAUCCUGCCACCUAUGUAUCU… | 3661 nt | 0.4433 | |
| CUUCAGAUAGAUUAUAUCUGGAGUGAAGAAUCCUGCCACCUAUGUAUCU… | 3426 nt | 0.4498 | |
| AGAAGAGCUGAGACAUCCGUUCCCCUACAAGAAACUCUCCCCGGGUGGA… | 3358 nt | 0.4500 |
This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]
A study in porcine skin demonstrated that the CCR5 was significantly increased at both 24 hours and 7 days following cutaneous bromine exposure, regardless of exposure duration (45 seconds or 8 minutes), and was identified as a potential therapeutic target involved in IL-10 and hepatic fibrosis/stellate cell activation signaling pathways [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. A study in mice demonstrated that spinal nerve ligation induced significant whole-transcriptome changes in injured dorsal root ganglia, with the CCR5 being upregulated 7.05-fold six days post-injury [Wu et al. DOI:10.1177/1744806916629048].