| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGCACCUGUGCUCCCAGGAUAAGGGUGAGCACUCAGGAUGACUGUG… | 1866 nt | 0.5032 |
The protein encoded by this gene is expressed only in Langerhans cells which are immature dendritic cells of the epidermis and mucosa. It is localized in the Birbeck granules, organelles present in the cytoplasm of Langerhans cells and consisting of superimposed and zippered membranes. It is a C-type lectin with mannose binding specificity, and it has been proposed that mannose binding by this protein leads to internalization of antigen into Birbeck granules and providing access to a nonclassical antigen-processing pathway. Mutations in this gene result in Birbeck granules deficiency or loss of sugar binding activity. [provided by RefSeq, Aug 2010]
A study in mice demonstrated that the CD207-positive Langerhans cells decreased over time following a thermal burn, remaining at approximately 20% of normal skin levels from day 7 to day 70 post-injury [Lateef et al. DOI:10.3390/ijms20030538]. In human acute wound healing, the CD207 was identified as a specific marker for Langerhans cells within the comprehensive single-cell atlas [Liu et al. DOI:10.1016/j.stem.2024.11.013].