Basic Information

Symbol
CD207
RNA class
mRNA
Alias
CD207 Molecule CLEC4K C-Type Lectin Domain Family 4 Member K Langerin Langerhans Cell Specific C-Type Lectin CD207 Molecule, Langerin CD207 Antigen, Langerin C-Type Lectin Domain Family 4, Member K CD207 Antigen
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_015717.5
Sequence length
1866.0 nt
GC content
0.5032

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-596.40 kcal/mol
Thermodynamic ensemble
Free energy: -632.56 kcal/mol
Frequency: 0.0000
Diversity: 363.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((...((((((((........)).)))))).(((.....))).((((((((((((...((((((((((...(((((((.....((((.........)))).(((((.(((....)))........((.(((....))).))))))).......)))))))..)))).))))))....((((.(((((......((((.((((((((((((((((((((((((....((((((((((...(((((.(((((((..........((..((((((.((((((...(((.....)))....))))))..))))))..))....................(((((.((((..((((((.(((...(((((........(((((..(((((((.(((((((((((.....(((...........)))....))))......)))))))))))))).)))))........)))))..))))))))).))))..)))))........((((...(((((((((((((((...(((.(..((((......))))..)..))).))))))..((((((.((((...((((((...))))))(((.((.....((...)).....)).))))))).))))))(((((.(((....))).))))).)))))))))))))............))))))).)))))))))....((((.(((.(((((((((.(..((.(((((..........))).)).))..)))))))))).)))..))))))))))............))).))))))).)...)))).)))))).))).))))((.(((...((((((......))))))...))).))..))))).))))(((((...)))))((..((((.......))))..)).....(((((.((((.(((..(((((...........)))))...))).)))).)).))).......((((((((...((((.(((((..(((..((((..(((......)))..)))))))......((((((.....))))))....)))))..))))...))))))))))))))))))))....((((((((((((...(((.....(((((((.........))))))).....)))...))))))))))))..((((....((((((((((((..(((.((.((((((((.(((((((((.(((((((.....((((....((.(((((((((((((((((((((..(((((..(((..((((.((...((((...((((((.(((.....))).........(((((((((....((((...)))))))))))))......................((((((..(((((.((..(.((((...........)))))..)).)))))...................((.(((.(((((.((((((....)))))))))))..)))))(((((((...))))))))))))).))))))...))))...)).)))).........))))))))..))))...)).))))..((.((((((.(.......).)))))).))(((.(((((....(((((((.........(((.((((((((((...)))))).............((((((...........))))))..)))).))).........))).))))...))))).)))..))))))))))).))))))....)))))).).))))))......((((((((.....))))))))))).)))))))).))..))).)))).....))))))))....))))......))))...((((((...)))))).
Thermodynamic Ensemble Prediction
.,.(((((((((((((((........)).)))))}.|}))....,|{.((((((((((((...((((((((((...(((((((......{({...,,|{{({|,((,((.(((({...,{..........))....}))).)).)),)))),......)))))))..)))).))))))....((((.((((({{.{{{((((.((((((((((((((((((((((((..,,(((((({{,,.,.(((((.(((((((..........,,..((((((.((((((...(((.....)))....))))))..)))))}{{|,.........,}},..,,...(((((.{(((..((((((.(((...((({{,,..{,..(((((..(((((((.(((((((({((..,,{({{..,,.....,,}}}...}))),.....})))))))))))))).))))}.|,....,))}))}.))})))))).})))..)))))....,...,(((...{(((((({{{(((((...(((.(..((((......))))..)..))).)))))|,.((((({,{(({...((((({...}))))),((.((.....({...}).....)).))))))).,}))})(((((.(({....})).))))),}))))))))}}))}...........))))))).))))),)}}....((((.(((.(((((((((.{..((.(((((.,......}.))).)).))..}))))))))).)))..)))))))))),.......},..))),,)))))).)...)))))))))))}})).))))|{.{{({({(((,,,.....}))))))...))).)),.})))).)))),((((...))))}((..((((.......))))..)}.....(((((.((((.(((..(((((...........)))))...))).)))).)).))).......((((((((...{{{{{(((((..{{..{((((..(((......)))..)))))}}......((((((.....))))))....)))))}.,}},...))))))))))))))))))))}.},((((((((((((.(,{((.....(((((((.........))))))).....))).},))))))))))))..((((....((((((((((((..(((.((,{(((((((.(((((((((.(((((((.....((((....((.((((((((((({{((((((((..(((({..(({.,{(,{,(({{,((,((((((((({.(((.....))).........(((((((((....((({...)))))))))))))...............,,.....((((((..(((((.((..{,(((({,......,,.}))))..,},)))))............,......{{.(((.(((({,((((((....)))))))))))..))),}{((((((...))))))})))))).}))))}..})))).)),.})))}.,....,,||}},}}))..)))).,.}}.}}}}..,{.((((((.(.......).)))))).|,(((.(((((....(((((((.........(((.((((((({((,..}}}))).............{(((((...,,......))))))}})))).))).........))).))))...))))).))).}))))))))))).))))))....)))))).).))))))}...,{((((((((.....))))))))))}.)))))))).)),.))).))))}....})))))))....))))......))))...((((((...)))))).

Transcripts

ID Sequence Length GC content
AGAAGCACCUGUGCUCCCAGGAUAAGGGUGAGCACUCAGGAUGACUGUG… 1866 nt 0.5032
Summary

The protein encoded by this gene is expressed only in Langerhans cells which are immature dendritic cells of the epidermis and mucosa. It is localized in the Birbeck granules, organelles present in the cytoplasm of Langerhans cells and consisting of superimposed and zippered membranes. It is a C-type lectin with mannose binding specificity, and it has been proposed that mannose binding by this protein leads to internalization of antigen into Birbeck granules and providing access to a nonclassical antigen-processing pathway. Mutations in this gene result in Birbeck granules deficiency or loss of sugar binding activity. [provided by RefSeq, Aug 2010]

Forensic Context

A study in mice demonstrated that the CD207-positive Langerhans cells decreased over time following a thermal burn, remaining at approximately 20% of normal skin levels from day 7 to day 70 post-injury [Lateef et al. DOI:10.3390/ijms20030538]. In human acute wound healing, the CD207 was identified as a specific marker for Langerhans cells within the comprehensive single-cell atlas [Liu et al. DOI:10.1016/j.stem.2024.11.013].