Basic Information

Symbol
CD248
RNA class
mRNA
Alias
CD248 Molecule TEM1 Tumor Endothelial Marker 1 Endosialin CD164L1 CD248 Molecule, Endosialin CD248 Antigen, Endosialin CD164 Sialomucin-Like 1 2610111G01Rik CD248 Antigen
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Tissue/body fluid identification

MANE select

Transcript ID
NM_020404.3
Sequence length
2551.0 nt
GC content
0.6539

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1113.70 kcal/mol
Thermodynamic ensemble
Free energy: -1155.82 kcal/mol
Frequency: 0.0000
Diversity: 779.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((.(((((....))))).))((((((((.(((((...((((((((((((((((.(((((((((((....(((((((((....)))))((.((.((((((((((((((.((.(((..((((..........))))..))).))..)))).))))..))))))..)))).((..((((((((.((((((.(.((((((((....))))))))).)))).))((.(((((((.((((.((((((((((..(((((((((..((((((.((((((((((((((((.((...))..)))).)))))))).)).....((((......))))))))))))(((.((((.....((......))..)))).))).((((((((((((.((((...((.((((.....)))).))))))))))))))...)))).......))))))))).)))))))))).))))))))))).))(((.......)))(((..(((((.(((((((((.(((.(((((((((....(.(((((((((((..((....((.(((.....)))))....)).)))))))).(((((((((.(((.((...))))).)))))))))))).)..))))))))).))).))).((((((.....((((.(((.(((.(((((.(..(((((..(((((((((((((.(((((((((...((.(((((((..((((.(((((((((.......))))))))).((((....))))(((.(((((((..((.(....).))..)))).((((((.((((((..((..((.(((....((((((.....(((((........((((((((.(.(((..((((((..((((.((((...))))))))..)))...)))..))).)..))))))))....((((((.((.(((((...((((((((.((.(((.(((......)))))).)).).)))))))..((((((((((.((((((((...))))).(((((((.((((((((((((.(.(((...((.((.((((((((...((.....(((((....)))))(((((.((((.((....))..)))))).)))((((((..(((((((((((.(((((((...((..(...(((..((((((((.(((..(((..(((..((.((((((..(((((.((.((((((..(((((.(((((((..((((((((..((((..((((((((.....((......))..)))).)).))((((((.((.((..........((.((((....(((.((.........)))))....)))).))..........)).)))))))).))))..))).)))))..)).)))))))))).))))))....))..))).))..)))))).))..))).....)))......))))))))))).)))...)..))..))))))).))).))).)))))...((((.......))))..((((.....))))...))))))...........)).)))))))).)).))....)))))))))))........))))).))))))).....(((....(((((..(((.((((....))))...)))..)))))....))).....))).)))))).)))).............))).)))).)))))).....))))))))))).))).)).))..))))))))).))).))).)))))))..))))))))).......................)))))))))....)))))).......((((...))))........))))).))..)))))..).)))))..))).)))...))))..))))))........))))))...)))))..)))..........................................))))))))..))...))))....))).)))))).....)).))))))))))))))))...))))).....((((((((((..((.((((..((..(((((((...))).))).)..))..)))).))...)).)))))))).(((((((...)))))))..(((((((((.....(((((..((..((.((((((...((((...))))...(((((((.(...(((.((((......((((...(((((((....))..)))))...)))))))).))).).)))..))))......((((((...))))))......((((((.(((((((((.(((.((((.((.((.((((((((((.((((((....)).......(((..((....))..)))))))))))))).(((((((.((((((((....(((.(((.((....))))).))).....)))))..)))))))))).......))).)).)))))).)))))))...))))))))))))))))).))..)))))))))))))))).....(((((........)))))))))))))(((((....))))).....((((((....))))))
Thermodynamic Ensemble Prediction
....,((,((((,....,}||},}}({({{{{,.(((((...((((((((((((((((.(((((((((((....(((((((((....)))))(({((.((((((((((((((.((.(((..((((..........))))..))).))..)))).))))..))))))..)}))}|,..((((((((...((((.(.((((((((....))))))))).)))).((((((...(,{(((((((((.(({,.(((((....))))},.((((...(((((((,(((((({((.,{||..,}}}.||||||||.,,..}}))||}}},...,{,({{.{{{{((((((({((....((((....{{..,,}).,,.}|||,||||,{(({(((({{{({{(((({..{{{|{({{{{(({,|{{{{{|.{{{((|.,|,.}})))||}|{({((((,.{{(((((((((((,{{{{.((({{.(({.,,||}..})))}}}}),|||(((.(((.(((.((((.......,})))))).))).))),)))}}))))}}...,.))))}})}}}},,)))))){(((((({.(((.((...})})),)))))))}))}}))...))))))),.)))))))))))},|||{||{{,,,{{|{,.,..))})...,|||||||}{{(((.((((({,(((((((((.,{,(.{{{{(((|,((((,{((((((((.......))))))))}.((((....)))),(((({(((((.(((,,..({(,.....}}}.{{{{{((((((({{{(((((((,({.,,,(((((((({,{,,.{,..,{||||||{|{((((({{(({.,||,||,.||{|,|||{..,)))))))).}))}.,.)))}}}})}),,|||||||||{,,{|||||}||}||,{{.{{(((((,,,.)|}}||}||({,,{(,(((|||,|..|,.(((||({{((((({((((.((({{......(((((((({...(((.(((.{(({{(.((((((((.((({{(((((({(,{(((,...}|||||},,,}}}}|(((((.((((.((....))..)))))).)))}{{,{{{,(((((((((((.(((((((...((.,(...(((..((((((({,(((..(((..(({.,((.((((((..(((((.((.((((((..{((((.(((((((..((((((((..((((..((((((((.....,,......},..)))).)).)}((((({,((.((..........((.((((....(({{((.........)))))....)))).)}..........)).)))))))).))))..)))},))))..)).)))))))))).))))))....))..))).))..)))))).)).}))).....)))......))))))))))).)))...)..))..))))))).))).)))},))))}))|{|{..,,,,.))}),,|(((.....)))}..,,)}})))))))).},,,),,.))))))..),))))))))......||,................((,({........}}}}.{{{({.,({,.((({....))))...))).,))))),,,.,},,,,..))),))))))..|||....,)},...,,},.,}...,}}||,||||.}}}}}))))})))}}},}}.}}}}..,,....|..},,..,)))}}))),,))))))).,,.,,}..................)))}))))),,..))))))))}))))),))))))))))),,},}.}},,..........,}.))))))))),..,}}},,,))}))))..,)))).,,,|{|,...,.}))}),,..........,.)).))))))))))).))))))..............))))))))..,,...))))....)))))))))).....)).))))))))))))))))...)))))..,,.((((({((((..{,.((((.,((..(((((((...})).))).},,))..}||}.},.,,}}.)))))))){(((((((...))))))}.,(((((((((.....(((((..((..((.((((((...{,((.((((((((.(((((((.{{{({({(((({.,.,{,(((,....,..})}....),}}))}}},...||}||||.||....,},,....,......((((((...)))))),,,.}))))))))))))}},|},(((.((((.((.((.((((((((((.(((({{{((({...|,}||||,.||{....)),})),))))))))))).(((((((.((((((((,...(((.(((.((....))))).)))...,,)))))..)))))))))}.......))).)).)))))).)))((((({......)))))))))))).))..))))))))))))))))....,(((({......,,}))))))))))))|||||....))))}.....|{((((....))))},

Transcripts

ID Sequence Length GC content
AGUCCGGGGGCAUCGCGAUGCUGCUGCGCCUGUUGCUGGCCUGGGCGGC… 2551 nt 0.6539
Summary

Predicted to enable extracellular matrix binding activity and extracellular matrix protein binding activity. Predicted to be involved in cell migration. Predicted to act upstream of or within several processes, including fibroblast migration; lymph node development; and positive regulation of endothelial cell apoptotic process. Located in extracellular exosome. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A review of multi-omics studies in humans identified the CD248 as an aging-associated transcriptome feature, where its expression was negatively correlated with aging in whole blood samples from a cohort of healthy people [Solovev et al. DOI:10.1016/j.mad.2019.111192]; the same biomarker was also identified as a proteomic aging biomarker with higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192]. A study in humans demonstrated that the CD248 exhibited a Gini impurity score of 0, being present in most pure urine samples and in some mixtures containing urine while being absent in mixtures without urine, classifying it as a discriminatory protein for urine identification within a proteomic workflow for body fluid classification [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].