| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCGGGGGCAUCGCGAUGCUGCUGCGCCUGUUGCUGGCCUGGGCGGC… | 2551 nt | 0.6539 |
Predicted to enable extracellular matrix binding activity and extracellular matrix protein binding activity. Predicted to be involved in cell migration. Predicted to act upstream of or within several processes, including fibroblast migration; lymph node development; and positive regulation of endothelial cell apoptotic process. Located in extracellular exosome. [provided by Alliance of Genome Resources, Jul 2025]
A review of multi-omics studies in humans identified the CD248 as an aging-associated transcriptome feature, where its expression was negatively correlated with aging in whole blood samples from a cohort of healthy people [Solovev et al. DOI:10.1016/j.mad.2019.111192]; the same biomarker was also identified as a proteomic aging biomarker with higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192]. A study in humans demonstrated that the CD248 exhibited a Gini impurity score of 0, being present in most pure urine samples and in some mixtures containing urine while being absent in mixtures without urine, classifying it as a discriminatory protein for urine identification within a proteomic workflow for body fluid classification [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].