| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUCUGCGCAGCUUCCCGAGGCUCCGCACCAGCCGCGCUUCUGUCCGC… | 3292 nt | 0.4025 | |
| AGUUCUGCGCAGCUUCCCGAGGCUCCGCACCAGCCGCGCUUCUGUCCGC… | 3634 nt | 0.4073 |
This gene encodes an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Expression of this gene in tumor cells is considered to be prognostic in many types of human malignancies, including colon cancer and renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015] CIViC Summary for CD274 Gene CD274, also commonly referred to as PDL1, is a ligand that binds with the receptor PD1, commonly found on T-cells, and acts to block T-cell activation. PD1 expression has been observed in a variety of cancers including melanoma and non-small cell lung cancer. The interaction of PD1/PDL1 is hypothesized to be a possible mechanism for the tumor to escape immune response. A number of checkpoint blockade inhibitors including pembrolizumab and nivolumab have been developed that target the PD1/PDL1 interaction in order to allow T-cells to recognize tumor cells without being deactivated by the tumor.
A study in mice demonstrated that the CD274 was significantly upregulated at 14 days post-injury in microglia isolated from brains following controlled cortical impact, identifying it as part of the IFNγ pathway during a specialized inflammatory state [Izzy et al. DOI:10.3389/fncel.2019.00307]. A study in human skin demonstrated that the CD274 is significantly up-regulated in thermally injured tissue compared to normal skin, as part of an extensive temporal gene expression profile during the early wound repair process [Greco et al. DOI:10.1016/j.burns.2009.06.211].