Basic Information

Symbol
CD38
RNA class
mRNA
Alias
CD38 Molecule ADP-Ribosyl Cyclase 1 CADPR1 ADP-Ribosyl Cyclase/Cyclic ADP-Ribose Hydrolase 1 2'-Phospho-Cyclic-ADP-Ribose Transferase 2'-Phospho-ADP-Ribosyl Cyclase Cyclic ADP-Ribose Hydrolase 1 NAD(+) Nucleosidase CD38 Antigen (P45) ADPRC 1 2'-Phospho-ADP-Ribosyl Cyclase/2'-Phospho-Cyclic-ADP-Ribose Transferase Ecto-Nicotinamide Adenine Dinucleotide Glycohydrolase Cluster Of Differentiation 38 CADPR Hydrolase 1 CD38 Antigen EC 2.4.99.20 EC 3.2.2.- EC 3.2.2.6 ADPRC1 T10
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_001775.4
Sequence length
5620.0 nt
GC content
0.4228

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1645.20 kcal/mol
Thermodynamic ensemble
Free energy: -1751.61 kcal/mol
Frequency: 0.0000
Diversity: 1520.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((.((((.((((((..((((.(((((.....((((((((((((((((((((....((((((((......((((((((.((((((((((((.((((((((...((((((....((((((((.((((((.(((((((((((...)))))))............)))).)))......)))..)).))))))))).)))))))))))))))))).....)).))).))))..)))).((((((((((................)))).)))))).)))).))))...(((...((((.((...((((((....)))))).)))))))))..(((((((((..(((((((...((((((((..............)))))))).......((((((((((((((..(((..(...((((((..(((((((((.(((((((..((((((((..((((((((((.(((((......((.(((......))).))..(((.((((....)))).))).((((.((((((.((....((.(((...))).))...)).)))).)).))))(((....(((.((((((((((((.............((((.(((.((......))..)))..)))).((((...((((((....))))))...))))...(((((((..((....)).))))))).((((((((((.(((...))))))))..))))).........................)))))))))))).)))..)))...)))))..))))))))))...((((((((((((...(((.((...((((.(((((((((((((((((....(((((...((...))..))))).....))))))))(((((((((...(((((...............((.((((((.((((((...((((..((((.((((((((((((..(((((...)))))..))..))))).)))))....))))..)))))))))).)))))).))))))).....)))))))))...(((((.....)))))(((((....((((....)))).))))).((((((((((((....)).(((((((((((......((((((((((....))))).....)))))....(((((((........((((((.((((((.(((((((((((((((........))))))).)).)))))).))))))....)))))))))))))((((((((..........(((((......((((((((........))))))))..((((....)))).))))).........(((.(((....)))..))).))))))))..(((((((((((..............)))))).))))).........)))))))))))......((((....))))...(((((((((((((...((((.....(((((....)))))......))))....)))).)))))))))....((((.((((.((((...))))......((((((..((((.......)).)))))))).....((((((((...))))))))...))))))))(((((.(((.......(((.((((((.((((((((((((...(((((((((((....))..)))))))))..)))))))))))).)))))).)))......)))(((.....)))(((((((.((......)).)))))))..........))))).....))))))))))((((((.(((((((((((((............((((((....)))))).........(((((..........))))).........)))))).)))((((((((........))))))))......)))))))))).))))))))).))))..)).))).)))))........)))))))..((..((((...))))..)).......)))))))).))))).)).............(((((......((.((.....)).))...)))))..........(((((.((......((((((.((((((..((..(((.((((((.(((((((((....(((((.((((((.(((......(((((((((((....))).))))))))......))).))).....)))...)))))....)))))))))...)))))).)))..))..))))))..))))))...))))))).........(((.((....)).))).)))))))))))))))...)..)))..)).)))))((((.............))))))))))).....................................((((((.((((((((...(((((.....)))))..)))))).........)).))))))((((.....)))).)))))))..)))))))))))))))).).)))))))(((((((..((((((((((.......((..(((((..(..((.(((((((....((((..(((((((((.((((((..((((.((.((.((((((((((((((((((..((((.(((((((((((((((.((.((((((((((.(((.(((.((((((.((((((.((((.(.((((((((((((((((((.(((((((..((((((.(((((((..((((((.(((((.((((((((((((.....((((.(((.(.((((....(((.(((((..((((((((.(((((((((.....(((((((..........((((.....(((((((((((((...(((((((((.(((((.......(((((((.((((.....................(((...))).....((((((((.....((((..........))))....)))))))).....)))).)))))))))))))))))))))......((((.((.....)).))))((((....)))).((..........)).....))))))))..)))))...(((((((((((..((....((((.((....((((....(((.((((..(((.....(((...........)))...((((((((((.(((((.......)))))..)))))))))).((((((((((...((((((((.((((((.((....((.(((((..(......(((((..(((.(((...))).)))....)))))..(((((.((....)).)))))((((((((((((....................(((((..((((..(((((((...)))))))...(((..(((.....)))))).((((((.....)))))).....(((((((((((((...(((((((((.((((((((...))))..))))......(((.((((....)))).))).(((((...((((((((((((((((((((((((.(((.......((((((((..(((..(((((((((((...((.((((..(((((((.(((((((.((((((.(........).))))..))(((((.((...........))))))).))))).)).))))))).....(((.(((.......))).)))...............))))))...)))))))))))..))).)))).))))))))))))...................(((.((((((....((((((((((.....(((((...(((..((((((........(((....)))..........((((((((..((........))..)))).........((((((((..........(((((...(((((((......)))).)))(((((((...((((......))))....))...)))))(((((.((((((((..........))))))....)))))))..((((((((((.....)))))))))).(((((((...((((...))))......)))))))..............(((.(((((((((((((.(((((..(((..........)))..))))).)))))))))).))).)))(((.((((((((.....((((((.......(((((.((.......)).)))))...(((.(((..((((....))))..))).))).(((((((.((((.((((((((....)))))...))))))).)).........)))))..))))))....(((...))).........((((((...))))))....)))))))).)))..........)))))............))))))))((((((((((((((.....(((......)))....))))))).)))))))))))...........))))))((((.(((.....)))))))(((((.(((.(((((....))))).))))))))......(((((.((..((((...............))))....)))))))............)))...)))))))))))))))..)))))))))))))))).........(((...(((((........))))).)))))))))......)))))).)))))....)))))))))((((((((((..(((.((..(((...)))..)).)))....))))..))))))...))))))))))))))))).)))))..((((.(((...)))))))..))))))))))))(((....)))....)..))))).)))).))).)))))))))))...)))))))))).......)))..)))).))).....))))...))))))..))..)))))))))))........)))))))))))...((((.(((((((((...((((.(((((.((((..((((((..((((......................)))))))))).)))).)))))))))..........))).)))))))))).)))))((.(((.(((...))).)))...))...................))))))))).)))..))))).)))...((((((((((.((((....(((....((((((........))))))..)))...)))))))).)))))))))).).)))..))))((((((.......))))))......((((....))))..)))))).)))))).))))).)))))).))))))).))))))))))))).)))))))))))))))))).).)))).)))))).)))))).))).))))))..))))))).)).))))))))))))))).))))..)))))))))))))))))).)).)).))))..)))))).)))))))))............))))....))))))).))..)..)))))...))......))))))))..((((((.((((((.............))))))))))))...((.....)))).))))))).....))).)).....))))).))))...))..))))...(((....))).)))).)))).....(((((.(((((((((...........)))))))))...)))))....................
Thermodynamic Ensemble Prediction
,.((((.((((........,(,(((.(((.(((,((((.((((((.{(,(((,........|||{,|,...{{(((((({{.((((((({{{,{{((,((((({{{({{{(({,.,{((({.....}}}||.||||(((((((...)))))))...,{{{({({{(({|{{{{......,}}.}))}}.{{||,,,.|||(((,,.((((((,||((((.{{{,((.(({....))).||,|||||||}}}}}}}.}}})}}..,,))})}}}}}.,((((((...)))))}.,((((.((...((((((....)))))).))}))}..{(.(((((((((..(((((((.,.((((((((..,{,......},.)))))))).,,....(((((((,,({{,..,{{,...,,,((((({.{((,,,((((,,{(((((..((((((((,.{(((((((((.(((((......((.(((,....|))).})..{{(.((((....)))).}}}.({((.((((((.{{..|.((.{({...))).)),}.)).)))).)}.))}|{((,,..(((.((((((((((({...........,,{{.,{({{|{{||{{..{{{,{((,.,,..,|,{|,}.||||||....))))}}.,.)))}...(((((((..((....)).))))))).{(((((((((.{({...}))))))).,))))),,.......,|..........,...}))))))))))).))}..))},,.}))))..)))))))))}.}}{(({{{{(((((...(((.((...((((.(((((((((({{(((((,,,,(((({,,,((.,.|},,|||||..,,{||||||}|{{{{(({{({...(((({.........))))}((.((({{{,(({(((,..((,(.,(,,((((((({(((({{..{((((...))))}..,)}}))))},)))))},,},})},.},,))))))),)))))),))}},,,....,})))))))},.,(((({.....})))}(((((....({{{.,..)))),))))}.{({{{((((({{...,)).(((((((((((......((((((((({....})))).....)))))....(((((((........((((((.((((((.(((((((((((((((........))))))).)),}))))).))))))....)))))))))))))((((((({..........{{{{,......((((((((........))))))))..{(((....)))}.,}}}}.........(((.(((....)))..))).})))))))..{((((((((((..............)))))).))))}......,..)))))))))))...,..((((....))))...(((((((((((((...((((,..,,,,(((,,..}})))},,}}.))))....)))),}))))))))...,((({,((({.,,,,..|||}}......((((((,,{,{,,,,....)),)})))))),,,,.((((((({...}))))))).,}))||||},(((((.(((....{,,({{.((((((.((((((((((((...(((((((((((....))..)))))))))..)))))))))))).)))))).})),,....))),,,,,,..}|,{((((((.((......)).))))))}.,{..,.,,.))))).....))))}}}}}}{{{{{(,{{,,{(({(((((............{(((((....)))))}..,,.....(((({..........})))).......,.)))))).)))||||||{|},.,},,,}}))))),......,,,,}}}}}),))))))))).))))..}),})).)))))....,,,.}||||||{,,,..(({{..,})}}..}},}}}}},}))))))).))))).)|||||,,,,,,,.,,||{{{,....{|.||.....}},|}...})))}..........((((,,((......{(((((,{(((((..((..(((.((((((.{((((((({.,..((((,.{{{{|,.{{{...||,{{{(((({{{{,,,,}}}.)))))))),,},.,)}}|}}}.....}))...}))}}....}))))))))...)))))).)))..))..)))))),,))}}}}...))))))).,|{...,{|||.{{,,,,.,.},}},})))}}))}|,,,}},})}}),,},)}.),}}}}|,|,.}}}..}}}}}}}),,))))))}.,...,,.......,......,}..,,|,....,,,,((((((.(((({{{{...((((({...,))))),.}}}},,,......,})).))))))((((.....)))).)))))))..))))))))),))))))})}))))}))|,|}|})))))}},|{|||.....,.||..(((((..,,,((.(((((((.,,.(((({,(((((((((.((((((,,((((.{(.((.((((((((((((((((((..((((.(((((((((((((((.((.(((((({(((.(((.(((.((((((.((((((.((((.(.((((((((((((((((((.(((((((..{(((((.(((((((..,(((((.(((((.((((({{(((({.....((((,(((.(.((((.,,.{,,.{{{{{..{{{(((({{({({((({{.....,{{{,,{.,,,......{{{{....,{{(({((((((((...(((((((((.{((((.......(((((((.((((,,...................{{{...}}}.....((((((((.....((((..........))))....)))))))).....)))).)))))))))))})))))))))......((((.((.....)).}))){(((....)))}.{{..........,,.....}))))))}..}}}}}.,,(({(((({{{{,||{||.{(((,.((({...|||}}}}|{{{((({..,{,,....{{{.......|,||}}|||,((((((((((.(((((.......)))))..)))))))))),{(((((((((...((((((((.((((((.{(....((.(({((,.{......{{{((,.(((.(({...))).)))....)))))..(((((.((....)).)))))((((((({((((.....{,.....,.......(((((..((((..(((((((...)))))))...{{{,.{((....,)})))}.((((((.....)))))).....(((((((((((((..{(((((...({((({,{{,.,,})))..,|{{{....))}|,((((....)))).|||{((,.((((((((((((,(({{(((((((((((.(((.......{{((((,({{(((..(((((((((((,,,((.({,,..(((((((,(((((((.((((((.{........}.))}}..}},{{{{,{{...........}))))),.))))).}}.}}}}}}}.....|||}||,....,{.,,}.))).....,,||||,,,,))))}}...)))))))))))..))).))),,)))}))))))))..........,{{{{,...,,,.||||||...,|(((((((((..,,,(((((,..{{{..,,{,{{.....,,.(((....|||........,,{{{{((((..((........))..)))).........((((((((..........(((((,{.{{,((((......)))){||{((((({{...((((......))))....},...))))){((((,{{((((((........,.)))))}....)))))))..((((((((({.....}))))))))).(((((((.,.((({...})))....}.)))))))..............(((.(((((((((((((.(((((..(((..........)))..))))).)))))))))).))).)))(((.((((((((.....((((((.......(((((.((.......)).)))))...(((.(((..((((....))))..))).))).{((({(,.((((.((((((((....)))))...))))))).},.........}}}}}..))))))....(({...}}).........((((((...))))))....)))))))).))).....}}).,)))))............))))))))((((((((((((((.....{,{,{{...,)))}..))))))).))))))))}))}}..,,,....}}||}|{{{{.{{{.....}))})))|((((.{((.(((((....))))).))}))))|.,..{.(((({.{{..((({.....,,.....||||,,,..},))))))}.,.....,,}},)))...)))))))))))))))..},}}},,}}))))))))).))}}..,(({{{(,((({{{.,,{{,,||,{||,{{..{....)..}}}||||{,||{|,.|||||}.}||}},,,,||...)))))...)))))))),),,||{.,|,}}}})}},,})))).}..))))))))))))))))).)))))..{{{,.{{{...,)))}}}.,))))))))))))(((....}}}....}..})))),)))).)))}}))))))))))...)))))))))}........,},,,,,,,|||,,..})).,.}}))}))).....,|||||||||||,......,||||||||||,...,{{{,(((((((((,..((((.(((((.((((..((((((,.{(((..................,...)))))))))).)))).)))))})))...,......))),})))))}}}}.,,,,,,,.{{{.{{({{{|,,..,)}}}).,,.,,,..,,,...,,,,,}}|}||}}}.))},.})))),,)),..|{(((({((,{((((....(((....((((((........))))))..)))...)))))))).)))))})))).}.}}),,)))){(((((.,....}))))))......|(((....))))..}})))).))))))})))))}))))}}.))))))).))))))))))))).)))))))))))))))))).).)))).)))))).)))))).))).))))))..})))))).)).))))))))))))))).))))..)))))))))))))))))).)).)),)))}..)))))).)))))))))}...........)))).,,.))))))).)),,)..)))))})))))}....,,,||||,..((((((.(((((({.........,}.,)))))))))))..,,|,}}..},,}.)))))),)).......}}.....))))))))))...)))..))).)))|}........)))).)))),....(((((.((((((((({{.....}}},}})))))))...)))))....................

Transcripts

ID Sequence Length GC content
GCAGUUUCAGAACCCAGCCAGCCUCUCUCUUGCUGCCUAGCCUCCUGCC… 5620 nt 0.4228
Summary

The protein encoded by this gene is a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Crystal structure analysis demonstrates that the functional molecule is a dimer, with the central portion containing the catalytic site. It is used as a prognostic marker for patients with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Forensic Context

A study in humans demonstrated that the CD38 exhibited a Gini impurity score of 0, being present in all pure seminal fluid samples and in mixtures containing semen while being absent in mixtures without semen, thus serving as a discriminatory protein for body fluid classification [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].