| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUCCGGUACCUGUGAGUCAGCUAGGGGAGGGCAGCUCUCACCCAGGC… | 701 nt | 0.5093 | |
| CUUUCCGGUACCUGUGAGUCAGCUAGGGGAGGGCAGCUCUCACCCAGGC… | 690 nt | 0.5101 |
The protein encoded by this gene is part of the T-cell receptor/CD3 complex (TCR/CD3 complex) and is involved in T-cell development and signal transduction. The encoded membrane protein represents the delta subunit of the CD3 complex, and along with four other CD3 subunits, binds either TCR alpha/beta or TCR gamma/delta to form the TCR/CD3 complex on the surface of T-cells. Defects in this gene are a cause of severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (SCIDBNK). Two transcript variants encoding different isoforms have been found for this gene. Other variants may also exist, but the full-length natures of their transcripts has yet to be defined. [provided by RefSeq, Feb 2009]
A study in elderly human hip fracture patients using single-cell RNA sequencing identified the CD3D as a T cell marker used for cell type identification and to characterize T cell clusters [Lu et al. DOI:10.1186/s12979-023-00380-6]. In a separate human study of a radiation-exposed patient, scRNA-Seq analysis showed the CD3D was highly expressed in specific NK cell subsets (NK2, NK5, NK7, NK8, NK9) and was involved in T-cell development and signal transduction, with T cell proportions notably lower in the irradiated patient compared to healthy controls [Yan et al. DOI:10.3892/etm.2025.12846]. A study in humans demonstrated that the CD3D is a gene marker highly expressed in the T cell cluster of the human corpus cavernosum, used alongside CD3E to identify this population [Zhao et al. DOI:10.1038/s41467-022-31950-9].