Basic Information

Symbol
CD3D
RNA class
mRNA
Alias
CD3 Delta Subunit Of T-Cell Receptor Complex T-Cell Surface Glycoprotein CD3 Delta Chain CD3-DELTA CD3DELTA T3D CD3d Antigen, Delta Polypeptide (TiT3 Complex) CD3d Molecule, Delta (CD3-TCR Complex) T-Cell Receptor T3 Delta Chain CD3 Antigen, Delta Subunit OKT3, Delta Chain CD3d Molecule CD3d Antigen CD3 Delta IMD19
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_000732.6
Sequence length
701.0 nt
GC content
0.5093

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-223.50 kcal/mol
Thermodynamic ensemble
Free energy: -236.97 kcal/mol
Frequency: 0.0000
Diversity: 146.59
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((.....(((((.((..((((((((((((..((((.((((...(((((.((((....))))..)))))..)))).))))....((..(((((.(((((.......)))))))))).)).(((((.(((((...((((.((((((((.((((..(((((((.(.(((....)))).)))))))..((((((...((((.........(((((.((((((.((((((((((.(((((....))))).))))..............(((..((((((.......))))))..)))......((((((..((........))..))))))..............))))))(.(((.((((......)))).))))......)))))).)))))..(((((((...)))))))(((((.......)))))))))...)))))))))))))))...)))((((((.((((.....)).)).))))))((..(((((((((((((((..(((.......(((....)))..........)))...)))))))...((((((.....))).))))).)))))).)).((((((..(((((.(((((...........))))).)))))..)))))))))).))))).))))).)))).)))))))).)).))))))))........................
Thermodynamic Ensemble Prediction
......(((.....(((((.((..((((((((,(((((........)))))((((((.(((((..(((((...,((.{{(({..{({.(((((,(((((.(((((.......))))))))))}))..)).})}(((((((..((((((((..{((((((((((((((.{.(((....))),.)))))))....,{{{{{(((((..(((.......)))))))}...,,.(((((..(((((....)))))})))).,}}}},....({.(((((((((..,..,.,,((((.(.....).)))}{(((((,.{(,{......)),.}))))),...{{........,,,.,,..(((.((((......)))).)))((((((((((((..{,{({...((({(.{{(((((((((((((.......))))))))..)))))...((((((......)))|||{{{,,((({{.{,||.,,.,}},)}}}))))),}.},))))))}})..))))),})))))).,,.}...}..)))))))))))....(((((((({{{,...,}}}{{|..,,..}}}...)))))))).....))))))}...,..))))....))))..)))))))})))).}).)))))))))))))))).)))))))).}).))))))))........................

Transcripts

ID Sequence Length GC content
CUUUCCGGUACCUGUGAGUCAGCUAGGGGAGGGCAGCUCUCACCCAGGC… 701 nt 0.5093
CUUUCCGGUACCUGUGAGUCAGCUAGGGGAGGGCAGCUCUCACCCAGGC… 690 nt 0.5101
Summary

The protein encoded by this gene is part of the T-cell receptor/CD3 complex (TCR/CD3 complex) and is involved in T-cell development and signal transduction. The encoded membrane protein represents the delta subunit of the CD3 complex, and along with four other CD3 subunits, binds either TCR alpha/beta or TCR gamma/delta to form the TCR/CD3 complex on the surface of T-cells. Defects in this gene are a cause of severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (SCIDBNK). Two transcript variants encoding different isoforms have been found for this gene. Other variants may also exist, but the full-length natures of their transcripts has yet to be defined. [provided by RefSeq, Feb 2009]

Forensic Context

A study in elderly human hip fracture patients using single-cell RNA sequencing identified the CD3D as a T cell marker used for cell type identification and to characterize T cell clusters [Lu et al. DOI:10.1186/s12979-023-00380-6]. In a separate human study of a radiation-exposed patient, scRNA-Seq analysis showed the CD3D was highly expressed in specific NK cell subsets (NK2, NK5, NK7, NK8, NK9) and was involved in T-cell development and signal transduction, with T cell proportions notably lower in the irradiated patient compared to healthy controls [Yan et al. DOI:10.3892/etm.2025.12846]. A study in humans demonstrated that the CD3D is a gene marker highly expressed in the T cell cluster of the human corpus cavernosum, used alongside CD3E to identify this population [Zhao et al. DOI:10.1038/s41467-022-31950-9].