| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUAGCUGCUGCACAGGCUGGCUGGCUGGCUGGCUGCUAAGGGCUGC… | 2690 nt | 0.4019 |
The protein encoded by this gene is the CD3 -gamma polypeptide, which together with CD3 -epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor- CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the CD3G is a highly specific mRNA marker for blood identification in singleplex reactions, requiring as little as 1 ng of input total RNA for detection [Haas et al. DOI:10.1016/j.fsigen.2010.09.006]. It was included in a medium-sensitivity pentaplex for forensic casework and performed well on environmentally compromised samples. Subsequent research incorporating targeted massively parallel sequencing confirmed the CD3G as a component in an extensive panel for blood detection and contributor assignment via coding region SNPs, with the panel showing reliable sensitivity down to 0.75 ng RNA input [Neis et al. DOI:10.1016/j.fsigen.2024.103125]. A study in human skin tissue demonstrated that T cells, identified by the CD3G, exhibited a significantly altered landscape following burn injury, with a lower proportion of CD8+ T cells and a higher proportion of CD4+ T cells in burn tissue compared to non-burn tissue [Labuz et al. DOI:10.7554/eLife.82626].