Basic Information

Symbol
CD3G
RNA class
mRNA
Alias
CD3 Gamma Subunit Of T-Cell Receptor Complex T-Cell Surface Glycoprotein CD3 Gamma Chain CD3-GAMMA CD3GAMMA CD3g Antigen, Gamma Polypeptide (TiT3 Complex) CD3g Molecule, Gamma (CD3-TCR Complex) T-Cell Receptor T3 Gamma Chain T3G T-Cell Antigen Receptor Complex, Gamma Subunit Of T3 CD3g Molecule, Epsilon (CD3-TCR Complex) CD3g Molecule CD3g Antigen IMD17
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mixture deconvolution Mechanical injury analysis

MANE select

Transcript ID
NM_000073.3
Sequence length
2690.0 nt
GC content
0.4019

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-701.12 kcal/mol
Thermodynamic ensemble
Free energy: -757.15 kcal/mol
Frequency: 0.0000
Diversity: 694.89
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((....(((((((((((.((((((.(.((.((((((........)))))))).)((((((((.((.((((.(((..(((((..(((((......)))))..)))))((((....((((....)))).....))))))))))).))......((((....))))((((((((((((((((.....))))))..((..((((((.(.......)))))))))....((((((....((((((((((((((((.......((((((((.........................)))))))).(((((.((((.(((((((((((((((..(((....(((((((.......((((....((((...))))......((((...((((((.(((((((......)))))))........)))))).))))...((((((.....))))))((((((((((((..((((((((..((((((((.........))))))))..))).....(((((((((....(((((...)))))......)))..)))))).)))))....)))))).))))))((.(((((((...(((.(((...)))......(((((((((((.((((((((((((....((((((...(((......))).))))))((((.(((((((((......)).)))))))..))))....((((((.((((((.((..(((....))).)).))))))((((((..((....((((..........)))).....))..))))))....(((((((.((((.(((((.(((((.(((.((((((((((.((((.((.((.(((((((((((((((((.................((((((..((....)))))))).))))))))))((.((((((((((.(((.........))).)))))))))).)).(((((..........(((....)))...........))))).........))))))).....)).))...)))).))))))...)))).......))).))))).))))).)))).)))))))((((((((.........))))))))...(((((((((.(......))).)))))))..)))))).)))))))))))).......)))).))))))).((((((....))))))...((((..............))))(((((...........)))))...((((((((...)))))))))))...))))))))).......)))).....)))))))...)))((((((((.....)).))))))....((((((((......))))))))...................)))))))))))..))))..)))).)))))...((((......)))).................))))))..))).)))))))...)))))).....))))))))))(((((((((((.((((......))))..((((......))))...((((((((((...((((....(((((((......)))))))..((((........))).)((((((((.((((..((..(((...........)))))..)))).....(((((((.....))))))))))))))).........)))).))))))))))((((.......))))....................)))))))))))))))))))........(((((.......))))).....))))))...)))...((((.((((((((...............................................))))))))))))...(((((.((.((((((((.(((((((((((((.((.......))))))))))..)))))...))))))))))))))).......)))..)))))....))))))).)))))...(((....))).....((((((((((...((((((((((((((((....((((((((.....(((((.........((((((......)).))))((.((((.(((...)))...)))).))(((((((.......)))).)))..(((((......))))).....((((((......))))))(((((.(((((((((((....(((((.....))))).....))))))))....)))...))))).....)))))....)))))))).....))))))))).....(((((((((...........((((((....(((((((((((((..((((((((((((((((.(..((((..(((..........)))..))))..).)))...((.((((((...)))))).)).(((((..((((((...(((.(((((.((...((((......))))...)).))))).))).))))))..))))).))))))))))))).........)))))))))))))...............((((((..(((((((..................)))))))..))))))....(((((........))))).............(((.((((..(....)..)))).)))......))))))..........)))))))))............))))))).....)))...))))))).
Thermodynamic Ensemble Prediction
((((((((((((....(((((((({(({(((,((({{(,{((((((,,...,..||,,,})},.((((({((,((.(((,.(((..(((((,.(((((......))))),.))))){|||,,,.||||,,,,.,)),.,,,))))))))))}.||....{,(({(.,,,)))}((((((((((((((((.....)))))),.((..((((((.(.......)))))))))....((((((....((((((((((((((((..,,...((((((({......,,{.............,,,)))))))).(((((.((((.(((((((((((((((.,({(....(((((((.,,.....,........(((((..(((..,.{(({,{{{(,,.,..(((((((......)))))))....}}},}}}|||,.{((((((((((.....((((...((((((((((((,,,.,((((,,,...,,,,,({{((.(({{((((((((.((..(((,{,....}}.)))..)).))))))))},})},,)),}}))),,,,.,)))}}}.)))))).))))))..))))..,,.,,{{...,{,,..||,,....|,,,(((((((...((((,(.(((((......))))).,).)))))))))))....,{||,{((((((({......)).))))))|,.|||},.})))))))))},,,,.||,,{{,....},}.|,..,})}}.}||}},,,,}))..))))).,,...(((((.(((((((({...{((,((((((.(((((........................))))).)))))).)).||....||(({.{{{(({((,{,((((({(((({{,{(((((..((....)))))))},{{{{{....,||||||{{{{{{{.{{|,,,,,,,,,}}}.,}}))))))},}|||{(((........,,{{(|...||,...........}}},}.,,,.||,...})}}|{{{{{{{,,,,,.,,..{(((((......))}}}},,.,,..,,,,,,,,,,.........,||||(((..,.{,,,||,,((((((({.({..(((((((((.(......))).)))))))...)).)}},.,})))).,,,}}}},,.,,}||{{{..,..((((((....))))))...,}))},............|||||{{|{.....,.....}}))},},)})))))}))))))))).)))))...}}((((..,.......))))....)))))))...}}}((((((((.....}).))))))....{{((((,{...,,,),}},||(((......)))}}...,,.)))))))))))..))))..)))).))))),,.((((......)))).}}....,,.,,,....))))))..))))))}))))...)))))).....,)))))))))((({(((((({{(((..{{{{{{,||..((({......)))}..,((((((((((...,,{{,,..,{{({{{..,||,|,,|,,,...{{{......,,}}},}{{||{{{{.({((,,{(,.({,..,,,....,,)},}}..)))).....(((((((.....)))))))}}}}}}}}..........,,..})))))))))|,}}})))...)))).,,,..,},,,,........})))}))))))|||}}}}),}..,,..{((((.......))))}..,,.))))))...,},....||}}}}..{(({.....,,,...........................................}}||.{((({{..(((.((.((((((((.(((((((((((((.((.......))))))))))..)))))...)))))))}))))))))))},,.)))..)))))....))))))),}))))...(((....))).....(((((((((({({((((((({..((((.(((((((((,{(((((....}))),.||.,(((((((({.....,,,,,,.((((.(((((((({{{,...((((...(((((((.......))))},))..(((((......)))))...))))|},}})..)))).))).)))).{{{{(((({{....|}}}}|((((..,|}}}...|}||}}}||,,,,||,,,.(((((,..,(((((((((...((((((((,,,{{,,.{{{,,......,.,|,{{,....,,|||.{(((((((((...{,{||||,{((((((((......(((((.{..((((..(((..........)))..))))..}.)))))..,,.,,|..}}})))))}..,..,}))}.)))))))))}..,|((({.{,...{{((,.....)))),..,,.}}}},...))))))))...)))))))))))))))..,,,...||{{||{{...{{|.{{........}}.,}}.{,||||}}|{(((((..................)))))}}..,)))))}},..}}}.....})))))))),,....,,,,...{{{{({,(,,(,.{{{..,,,,..))}.,}}}}}|}},......,.)))))))))))))..}.......))))))).})}.)))...))))))).

Transcripts

ID Sequence Length GC content
AGUCUAGCUGCUGCACAGGCUGGCUGGCUGGCUGGCUGCUAAGGGCUGC… 2690 nt 0.4019
Summary

The protein encoded by this gene is the CD3 -gamma polypeptide, which together with CD3 -epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor- CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the CD3G is a highly specific mRNA marker for blood identification in singleplex reactions, requiring as little as 1 ng of input total RNA for detection [Haas et al. DOI:10.1016/j.fsigen.2010.09.006]. It was included in a medium-sensitivity pentaplex for forensic casework and performed well on environmentally compromised samples. Subsequent research incorporating targeted massively parallel sequencing confirmed the CD3G as a component in an extensive panel for blood detection and contributor assignment via coding region SNPs, with the panel showing reliable sensitivity down to 0.75 ng RNA input [Neis et al. DOI:10.1016/j.fsigen.2024.103125]. A study in human skin tissue demonstrated that T cells, identified by the CD3G, exhibited a significantly altered landscape following burn injury, with a lower proportion of CD8+ T cells and a higher proportion of CD4+ T cells in burn tissue compared to non-burn tissue [Labuz et al. DOI:10.7554/eLife.82626].