Basic Information

Symbol
CD40LG
RNA class
mRNA
Alias
CD40 Ligand CD40-L CD40L TRAP TNF-Related Activation Protein HCD40L TNFSF5 CD154 HIGM1 T-BAM Gp39 Tumor Necrosis Factor (Ligand) Superfamily Member 5 T-B Cell-Activating Molecule CD40 Antigen Ligand T-Cell Antigen Gp39 IMD3 Tumor Necrosis Factor (Ligand) Superfamily, Member 5 (Hyper-IgM Syndrome) Tumor Necrosis Factor Ligand Superfamily Member 5 Hyper-IgM Syndrome CD154 Antigen IGM
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_000074.3
Sequence length
1852.0 nt
GC content
0.4449

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-469.50 kcal/mol
Thermodynamic ensemble
Free energy: -507.17 kcal/mol
Frequency: 0.0000
Diversity: 449.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((.((((((((......(.((((........)))).)...)))))))))))(((..(.((((((.(((((..((((((.(((((((..(((........................(((..((((((...)).))))..))).(((((((....))))))).......................(((((......))))).((((.....))))((((.......(((((((..(((..(((.(((((((....(((...((((((((.........))))))))...((.(((((((..........((((((((......(((((((......))))))).....((((((........))))))(.((((((......(((......(((((((((...((((((...((.((((.........)))).))..............((((((((.(((.......)))..))).))))).........(((((((..((((((((((.....(((((....((((.(........).))))..(((........))).....((((.(((.....(((....((((..................))))....)))........)))((((((((.(((..(((((((((.(((((((((.((((.............(((((((((....))))).)))))))))))(((((((((......(((((........))))).......(((......)))..((((((((((.........)))))))))))))))))))(((.(((((((.((..((...(((((((((.((.((((....)).))))..)))))))))....))..)).))..))))).)))..)))))))))))))))...))).)))).))))......))))...((((((((............))))))))...........(((.(((..((((....)))).................))).)))(((((.((.(((((((......))))))).)))))))...((.....)).....((((.....)))).....)))))....))))....))))))))))))).....((((((.....(((((.(((((((((((......(((((((...((((.........)))))))))))(((..(((..((((((.((((((((((((.(((((......))))).)))))...........))))))).))))))..))).)))((((((.(((....((.(((....))).))...))))))))).)))))))))))((.(((((...(((((((....((...))....)))))..))....))))).))......(((.........)))................)))))....))))))...........)))))).))))).))))...)))....)))))))......))))))))....))))))).))...................)))....)))).))))))...)))..)))))))......))))...........................................(((((((((((..(((.(.((.((((((.((((.((((((....((((..........))))...)))))).)))).))))))))))))..)).)))))...)))).......))).))).))))..))))))))))).....)))))).)..)))((((..(((((((..(((((((....(((((......))))))))))))..)))))))..))))............
Thermodynamic Ensemble Prediction
......(((.((((((((......(.((((........)))),,...)))))))))))(({.,(.((((((.{({{{..((((((.,{,(((,(((((.......................))))),||((((..,{{.|||,}}}...(((((((....))))))).....,....,|,..........(((((,....,))))),{(((.....))))|(({.......(((((((..(((..(((.(((((((....(({...((((((((.........))))))))...{{.,,((((({,..{,{.{((((({({((({{{.(((((((......))))))).....((((((........))))))..,|}|||}.....,,.....{,((((((((,(((((((((...,,,({{{.....,}..,,||{||,..,{,..,,,,..{(((((((.(((.......)))..))).))))}.........{{||{{|,,|(({((((((,,..,((({,....((((.{........}.))))..(((........)))....,((({.(((,,...,(({,,(((({.....,......,}....}))}.,,,,,}|},.....})){{||||{{.,(({.((((((({{{(((((((({{((((.............(((((((((....)))))},))))))))))(((((((((....(,{((((........))))),.....,(((......))),.((((((((((.........)))))))))))))))))))(({.(((((((.{{..((...(((((((((.{(.{{||,,..)),)},)..)))))))))....}}..)).})}.})))).)))..)))))))))))))))}}}|||,}}}}.}}}}......}}},..,({((({{{.........,.,)}}})))},,...........||||,..{|((,..,||||...,,,.....},,..})))}})}(((((.({.(((((((......))))))).}))))))...{|.....|||..,,((({.....}}}}.....,,)))...,))),...})}})))}}})))}.....((((((.....(((({.(((((((((((......(((((((...{(((......,,}}}}})))))))(((..(((..((((((.((((((((((((.(((((......))))).))))).,{,....,},))))))).))))))..))}.)))((((((.(((.,,,{{.{{{....))}.))}..))))))))).))))))))))}((.(((((...(((((({....{{.........)))))..))....}))))})}......,,{,,.......,))...,............})))}....,,))}),,.....,,,.),))))}))))}.))}}.......}))))))))...}}})))))),,,....}},))}),)),,,.}}}..}}}}}}....)))....)))).))))))...)))..)))))))......,,},,........................................,,|}}||,||}}|,,({,,({{{.{((,,,.,,...,{{{{{..,,{((({(.{{....,}.)))},))))||{{{(({.((|{{.((,,......)))),)),))))))},....}},,))})))),.})))))}}}},.....)))))).,,})))((((..(((((((..(((((((....{((({......)))})))))))}..)))))))..))))............

Transcripts

ID Sequence Length GC content
AAUCCUGAGUAAGGUGGCCACUUUGACAGUCUUCUCAUGCUGCCUCUGC… 1852 nt 0.4449
Summary

The protein encoded by this gene is expressed on the surface of T cells. It regulates B cell function by engaging CD40 on the B cell surface. A defect in this gene results in an inability to undergo immunoglobulin class switch and is associated with hyper-IgM syndrome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human cadavers demonstrated that the CD40LG was down-regulated (-3.003 fold) in decaying liver tissues compared to a control, as part of the apoptotic thanatotranscriptome where pro-apoptotic genes were up-regulated and anti-apoptotic genes were down-regulated with increasing postmortem interval [Javan et al. DOI:10.1007/S12024-015-9704-6]. A systematic review of immunohistochemical methods for post-mortem interval (PMI) estimation in human and animal model tissues found that tartrate-resistant acid phosphatase (TRAP) shows positive immunostaining in osteoclasts within bone marrow for PMIs of less than seven days, while staining is usually negative for intervals exceeding seven days [Salerno et al. DOI:10.3390/diagnostics12092114].