| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUCCUGAGUAAGGUGGCCACUUUGACAGUCUUCUCAUGCUGCCUCUGC… | 1852 nt | 0.4449 |
The protein encoded by this gene is expressed on the surface of T cells. It regulates B cell function by engaging CD40 on the B cell surface. A defect in this gene results in an inability to undergo immunoglobulin class switch and is associated with hyper-IgM syndrome. [provided by RefSeq, Jul 2008]
A study in human cadavers demonstrated that the CD40LG was down-regulated (-3.003 fold) in decaying liver tissues compared to a control, as part of the apoptotic thanatotranscriptome where pro-apoptotic genes were up-regulated and anti-apoptotic genes were down-regulated with increasing postmortem interval [Javan et al. DOI:10.1007/S12024-015-9704-6]. A systematic review of immunohistochemical methods for post-mortem interval (PMI) estimation in human and animal model tissues found that tartrate-resistant acid phosphatase (TRAP) shows positive immunostaining in osteoclasts within bone marrow for PMIs of less than seven days, while staining is usually negative for intervals exceeding seven days [Salerno et al. DOI:10.3390/diagnostics12092114].